AB292682.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0071949FAD bindingInteracting selectively and non-covalently with the oxidized form, FAD, of flavin-adenine dinucleotide, the coenzyme or the prosthetic group of various flavoprotein oxidoreductase enzymes. [GOC:mah]
GO:0050660flavin adenine dinucleotide binding
GO:0055114oxidation-reduction processA metabolic process that results in the removal or addition of one or more electrons to or from a substance, with or without the concomitant removal or addition of a proton or protons. [GOC:dhl, GOC:ecd, GOC:jh2, GOC:jid, GOC:mlg, GOC:rph]
GO:0016491oxidoreductase activity
INTERPRO:IPR036318FAD-bd_PCMH-like_sf
INTERPRO:IPR016166FAD-bd_PCMH
INTERPRO:IPR006094Oxid_FAD_bind_N
INTERPRO:IPR016167FAD-bd_PCMH_sub1
INTERPRO:IPR012951BBE

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR012951Berberine/berberine-likePFAMPF08031BBEcoord: 479..537
e-value: 1.2E-22
score: 79.7
IPR016167FAD-binding, type PCMH, subdomain 1GENE3D3.30.43.10coord: 28..135
e-value: 2.4E-44
score: 151.6
NoneNo IPR availableGENE3D3.40.462.20coord: 254..475
e-value: 4.7E-160
score: 535.1
NoneNo IPR availableGENE3D3.30.465.50coord: 140..538
e-value: 4.7E-160
score: 535.1
NoneNo IPR availablePANTHERPTHR32448:SF60BERBERINE BRIDGE ENZYME-LIKE 18coord: 16..539
NoneNo IPR availablePANTHERPTHR32448FAMILY NOT NAMEDcoord: 16..539
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 20..28
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..28
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 29..544
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..7
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 8..19
NoneNo IPR availableSIGNALP_EUKSignalP-noTMSignalP-noTMcoord: 1..28
score: 0.7
NoneNo IPR availableTMHMMTMhelixcoord: 5..27
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..8
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 9..30
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 31..58
NoneNo IPR availableTMHMMTMhelixcoord: 10..32
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 29..46
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..28
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 47..52
NoneNo IPR availableTMHMMTMhelixcoord: 28..45
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..14
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 15..40
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 41..66
NoneNo IPR availableTMHMMTMhelixcoord: 15..37
IPR006094FAD linked oxidase, N-terminalPFAMPF01565FAD_binding_4coord: 81..217
e-value: 2.1E-24
score: 85.8
IPR016166FAD-binding domain, PCMH-typePROSITEPS51387FAD_PCMHcoord: 77..251
score: 17.763
IPR036318FAD-binding, type PCMH-like superfamilySUPERFAMILY56176FAD-binding/transporter-associated domain-likecoord: 30..252

  • Cannabis sativa CBDAS mRNA for cannabidiolic acid synthase
  • complete cds
Sequences
Sequence
ATGAAGTGCTCAACATTCTCCTTTTGGTTTGTTTGCAAGATAATATTTTT
CTTTTTCTCATTCAATATCCAAACTTCCATTGCTAATCCTCGAGAAAACT
TCCTTAAATGCTTCTCGCAATATATTCCCAATAATGCAACAAATCTAAAA
CTCGTATACACTCAAAACAACCCATTGTATATGTCTGTCCTAAATTCGAC
AATACACAATCTTAGATTCACCTCTGACACAACCCCAAAACCACTTGTTA
TCGTCACTCCTTCACATGTCTCTCATATCCAAGGCACTATTCTATGCTCC
AAGAAAGTTGGCTTGCAGATTCGAACTCGAAGTGGTGGTCATGATTCTGA
GGGCATGTCCTACATATCTCAAGTCCCATTTGTTATAGTAGACTTGAGAA
ACATGCGTTCAATCAAAATAGATGTTCATAGCCAAACTGCATGGGTTGAA
GCCGGAGCTACCCTTGGAGAAGTTTATTATTGGGTTAATGAGAAAAATGA
GAATCTTAGTTTGGCGGCTGGGTATTGCCCTACTGTTTGCGCAGGTGGAC
ACTTTGGTGGAGGAGGCTATGGACCATTGATGAGAAACTATGGCCTCGCG
GCTGATAATATCATTGATGCACACTTAGTCAACGTTCATGGAAAAGTGCT
AGATCGAAAATCTATGGGGGAAGATCTCTTTTGGGCTTTACGTGGTGGTG
GAGCAGAAAGCTTCGGAATCATTGTAGCATGGAAAATTAGACTGGTTGCT
GTCCCAAAGTCTACTATGTTTAGTGTTAAAAAGATCATGGAGATACATGA
GCTTGTCAAGTTAGTTAACAAATGGCAAAATATTGCTTACAAGTATGACA
AAGATTTATTACTCATGACTCACTTCATAACTAGGAACATTACAGATAAT
CAAGGGAAGAATAAGACAGCAATACACACTTACTTCTCTTCAGTTTTCCT
TGGTGGAGTGGATAGTCTAGTCGACTTGATGAACAAGAGTTTTCCTGAGT
TGGGTATTAAAAAAACGGATTGCAGACAATTGAGCTGGATTGATACTATC
ATCTTCTATAGTGGTGTTGTAAATTACGACACTGATAATTTTAACAAGGA
AATTTTGCTTGATAGATCCGCTGGGCAGAACGGTGCTTTCAAGATTAAGT
TAGACTACGTTAAGAAACCAATTCCAGAATCTGTATTTGTCCAAATTTTG
GAAAAATTATATGAAGAAGATATAGGAGCTGGGATGTATGCGTTGTACCC
TTACGGTGGTATAATGGATGAGATTTCAGAATCAGCAATTCCATTCCCTC
ATCGAGCTGGAATCTTGTATGAGTTATGGTACATATGTAGTTGGGAGAAG
CAAGAAGATAACGAAAAGCATCTAAACTGGATTAGAAATATTTATAACTT
CATGACTCCTTATGTGTCCAAAAATCCAAGATTGGCATATCTCAATTATA
GAGACCTTGATATAGGAATAAATGATCCCAAGAATCCAAATAATTACACA
CAAGCACGTATTTGGGGTGAGAAGTATTTTGGTAAAAATTTTGACAGGCT
AGTAAAAGTGAAAACCCTGGTTGATCCCAATAACTTTTTTAGAAACGAAC
AAAGCATCCCACCTCTTCCACGGCATCGTCATTAA
Sequence Length
1635
Sequence Checksum
5bb10fc8bf3be2d6f14103745a056535
Summary
Resource Type
mRNA
Accession
AB292682.1
Organism
Name
AB292682.1
Identifier
AB292682.1
Time Accessioned
Friday, October 21, 2022 - 20:22
Time Last Modified
Friday, October 21, 2022 - 20:22