AB057805.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0071949FAD bindingInteracting selectively and non-covalently with the oxidized form, FAD, of flavin-adenine dinucleotide, the coenzyme or the prosthetic group of various flavoprotein oxidoreductase enzymes. [GOC:mah]
GO:0050660flavin adenine dinucleotide binding
GO:0055114oxidation-reduction processA metabolic process that results in the removal or addition of one or more electrons to or from a substance, with or without the concomitant removal or addition of a proton or protons. [GOC:dhl, GOC:ecd, GOC:jh2, GOC:jid, GOC:mlg, GOC:rph]
GO:0016491oxidoreductase activity
INTERPRO:IPR036318FAD-bd_PCMH-like_sf
INTERPRO:IPR016166FAD-bd_PCMH
INTERPRO:IPR006094Oxid_FAD_bind_N
INTERPRO:IPR016167FAD-bd_PCMH_sub1
INTERPRO:IPR012951BBE

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 29..48
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..28
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 49..59
NoneNo IPR availableTMHMMTMhelixcoord: 22..44
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..26
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 46..48
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 27..45
NoneNo IPR availableGENE3D3.40.462.20coord: 256..478
e-value: 2.4E-170
score: 568.9
NoneNo IPR availableGENE3D3.30.465.50coord: 142..541
e-value: 2.4E-170
score: 568.9
NoneNo IPR availablePANTHERPTHR32448FAMILY NOT NAMEDcoord: 18..542
NoneNo IPR availablePANTHERPTHR32448:SF60BERBERINE BRIDGE ENZYME-LIKE 18coord: 18..542
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 26..547
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..6
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 7..25
NoneNo IPR availableSIGNALP_EUKSignalP-noTMSignalP-noTMcoord: 1..30
score: 0.72
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
IPR012951Berberine/berberine-likePFAMPF08031BBEcoord: 482..540
e-value: 7.7E-24
score: 83.5
IPR016167FAD-binding, type PCMH, subdomain 1GENE3D3.30.43.10coord: 30..137
e-value: 3.6E-46
score: 157.4
IPR006094FAD linked oxidase, N-terminalPFAMPF01565FAD_binding_4coord: 83..219
e-value: 4.2E-27
score: 94.6
IPR016166FAD-binding domain, PCMH-typePROSITEPS51387FAD_PCMHcoord: 79..253
score: 18.146
IPR036318FAD-binding, type PCMH-like superfamilySUPERFAMILY56176FAD-binding/transporter-associated domain-likecoord: 31..254

  • Cannabis sativa mRNA for tetrahydrocannabinolic acid synthase precursor
  • complete cds
Sequences
Sequence
AAAAAAATCATTAGGACTGAAGAAAAATGAATTGCTCAGCATTTTCCTTT
TGGTTTGTTTGCAAAATAATATTTTTCTTTCTCTCATTCCATATCCAAAT
TTCAATAGCTAATCCTCGAGAAAACTTCCTTAAATGCTTCTCAAAACATA
TTCCCAACAATGTAGCAAATCCAAAACTCGTATACACTCAACACGACCAA
TTGTATATGTCTATCCTGAATTCGACAATACAAAATCTTAGATTCATCTC
TGATACAACCCCAAAACCACTCGTTATTGTCACTCCTTCAAATAACTCCC
ATATCCAAGCAACTATTTTATGCTCTAAGAAAGTTGGCTTGCAGATTCGA
ACTCGAAGCGGTGGCCATGATGCTGAGGGTATGTCCTACATATCTCAAGT
CCCATTTGTTGTAGTAGACTTGAGAAACATGCATTCGATCAAAATAGATG
TTCATAGCCAAACTGCGTGGGTTGAAGCCGGAGCTACCCTTGGAGAAGTT
TATTATTGGATCAATGAGAAGAATGAGAATCTTAGTTTTCCTGGTGGGTA
TTGCCCTACTGTTGGCGTAGGTGGACACTTTAGTGGAGGAGGCTATGGAG
CATTGATGCGAAATTATGGCCTTGCGGCTGATAATATTATTGATGCACAC
TTAGTCAATGTTGATGGAAAAGTTCTAGATCGAAAATCCATGGGAGAAGA
TCTGTTTTGGGCTATACGTGGTGGTGGAGGAGAAAACTTTGGAATCATTG
CAGCATGGAAAATCAAACTGGTTGCTGTCCCATCAAAGTCTACTATATTC
AGTGTTAAAAAGAACATGGAGATACATGGGCTTGTCAAGTTATTTAACAA
ATGGCAAAATATTGCTTACAAGTATGACAAAGATTTAGTACTCATGACTC
ACTTCATAACAAAGAATATTACAGATAATCATGGGAAGAATAAGACTACA
GTACATGGTTACTTCTCTTCAATTTTTCATGGTGGAGTGGATAGTCTAGT
CGACTTGATGAACAAGAGCTTTCCTGAGTTGGGTATTAAAAAAACTGATT
GCAAAGAATTTAGCTGGATTGATACAACCATCTTCTACAGTGGTGTTGTA
AATTTTAACACTGCTAATTTTAAAAAGGAAATTTTGCTTGATAGATCAGC
TGGGAAGAAGACGGCTTTCTCAATTAAGTTAGACTATGTTAAGAAACCAA
TTCCAGAAACTGCAATGGTCAAAATTTTGGAAAAATTATATGAAGAAGAT
GTAGGAGCTGGGATGTATGTGTTGTACCCTTACGGTGGTATAATGGAGGA
GATTTCAGAATCAGCAATTCCATTCCCTCATCGAGCTGGAATAATGTATG
AACTTTGGTACACTGCTTCCTGGGAGAAGCAAGAAGATAATGAAAAGCAT
ATAAACTGGGTTCGAAGTGTTTATAATTTTACGACTCCTTATGTGTCCCA
AAATCCAAGATTGGCGTATCTCAATTATAGGGACCTTGATTTAGGAAAAA
CTAATCATGCGAGTCCTAATAATTACACACAAGCACGTATTTGGGGTGAA
AAGTATTTTGGTAAAAATTTTAACAGGTTAGTTAAGGTGAAAACTAAAGT
TGATCCCAATAATTTTTTTAGAAACGAACAAAGTATCCCACCTCTTCCAC
CGCATCATCATTAATTATCTTTAAATAGATATATTTCCCTTATCAATTAG
TTAATCATTATACCATACATACATTTATTGTATATAGTTTATCTACTCAT
ATTATGTATGCTCCCAAGTATGAAAATCTACATTAGAACTGTGTAGACAA
TCATAAGATATATTTAATAAAATAAATTGTCTTTCTTATTTCAATAGCAA
ATAAAATAATATTATTTTAAAAAAAAAAAAAAAAA
Sequence Length
1885
Sequence Checksum
d04d9eb687db66be654d7e76c79f29e5
Summary
Resource Type
mRNA
Accession
AB057805.1
Organism
Name
AB057805.1
Identifier
AB057805.1
Time Accessioned
Friday, October 21, 2022 - 20:21
Time Last Modified
Friday, October 21, 2022 - 20:21