AB164375.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0016746transferase activity, transferring acyl groupsCatalysis of the transfer of an acyl group from one compound (donor) to another (acceptor). [GOC:jl, ISBN:0198506732]
GO:0016747transferase activity, transferring acyl groups other than amino-acyl groupsCatalysis of the transfer of an acyl group, other than amino-acyl, from one compound (donor) to another (acceptor). [GOC:jl]
GO:0009058biosynthetic processThe chemical reactions and pathways resulting in the formation of substances; typically the energy-requiring part of metabolism in which simpler substances are transformed into more complex ones. [GOC:curators, ISBN:0198547684]
GO:0003824catalytic activity
INTERPRO:IPR018088Chalcone/stilbene_synthase_AS
INTERPRO:IPR011141Polyketide_synthase_type-III
INTERPRO:IPR016039Thiolase-like
INTERPRO:IPR012328Chalcone/stilbene_synth_C
INTERPRO:IPR001099Chalcone/stilbene_synthase_N

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR001099Chalcone/stilbene synthase, N-terminalPFAMPF00195Chal_sti_synt_Ncoord: 3..221
e-value: 8.3E-101
score: 336.1
IPR012328Chalcone/stilbene synthase, C-terminalPFAMPF02797Chal_sti_synt_Ccoord: 232..382
e-value: 1.4E-63
score: 213.4
IPR016039Thiolase-likeGENE3D3.40.47.10coord: 1..229
e-value: 1.8E-79
score: 268.5
IPR016039Thiolase-likeGENE3D3.40.47.10coord: 230..384
e-value: 9.7E-54
score: 182.8
IPR016039Thiolase-likeSUPERFAMILY53901Thiolase-likecoord: 3..225
IPR016039Thiolase-likeSUPERFAMILY53901Thiolase-likecoord: 229..381
IPR011141Polyketide synthase, type IIIPIRSFPIRSF000451PKS_IIIcoord: 1..383
e-value: 2.2E-121
score: 401.2
IPR011141Polyketide synthase, type IIIPANTHERPTHR11877HYDROXYMETHYLGLUTARYL-COA SYNTHASEcoord: 4..382
NoneNo IPR availablePANTHERPTHR11877:SF14CHALCONE SYNTHASEcoord: 4..382
IPR018088Chalcone/stilbene synthase, active sitePROSITEPS00441CHALCONE_SYNTHcoord: 149..165

  • Cannabis sativa OLS mRNA for olivetol synthase
  • complete cds
Sequences
Sequence
ATGAATCATCTTCGTGCTGAGGGTCCGGCCTCCGTTCTCGCCATTGGCAC
CGCCAATCCGGAGAACATTTTATTACAAGATGAGTTTCCTGACTACTATT
TTCGCGTCACCAAAAGTGAACACATGACTCAACTCAAAGAAAAGTTTCGA
AAAATATGTGACAAAAGTATGATAAGGAAACGTAACTGTTTCTTAAATGA
AGAACACCTAAAGCAAAACCCAAGATTGGTGGAGCACGAGATGCAAACTC
TGGATGCACGTCAAGACATGTTGGTAGTTGAGGTTCCAAAACTTGGGAAG
GATGCTTGTGCAAAGGCCATCAAAGAATGGGGTCAACCCAAGTCTAAAAT
CACTCATTTAATCTTCACTAGCGCATCAACCACTGACATGCCCGGTGCAG
ACTACCATTGCGCTAAGCTTCTCGGACTGAGTCCCTCAGTGAAGCGTGTG
ATGATGTATCAACTAGGCTGTTATGGTGGTGGAACCGTTCTACGCATTGC
CAAGGACATAGCAGAGAATAACAAAGGCGCACGAGTTCTCGCCGTGTGTT
GTGACATAATGGCTTGCTTGTTTCGTGGGCCTTCAGAGTCTGACCTCGAA
TTACTAGTGGGACAAGCTATCTTTGGTGATGGGGCTGCTGCGGTGATTGT
TGGAGCTGAACCCGATGAGTCAGTTGGGGAAAGGCCGATATTTGAGTTGG
TGTCAACTGGGCAAACAATCTTACCAAACTCGGAAGGAACTATTGGGGGA
CATATAAGGGAAGCAGGACTGATATTTGATTTACATAAGGATGTGCCTAT
GTTGATCTCTAATAATATTGAGAAATGTTTGATTGAGGCATTTACTCCTA
TTGGGATTAGTGATTGGAACTCCATATTTTGGATTACACACCCAGGTGGG
AAAGCTATTTTGGACAAAGTGGAGGAGAAGTTGCATCTAAAGAGTGATAA
GTTTGTGGATTCACGTCATGTGCTGAGTGAGCATGGGAATATGTCTAGCT
CAACTGTCTTGTTTGTTATGGATGAGTTGAGGAAGAGGTCGTTGGAGGAA
GGGAAGTCTACCACTGGAGATGGATTTGAGTGGGGTGTTCTTTTTGGGTT
TGGACCAGGTTTGACTGTCGAAAGAGTGGTCGTGCGTAGTGTTCCCATCA
AATATTAA
Sequence Length
1158
Sequence Checksum
30eab3dc8a5f760d50d8bdfbb829c20c
Summary
Resource Type
mRNA
Accession
AB164375.1
Organism
Name
AB164375.1
Identifier
AB164375.1
Time Accessioned
Friday, October 21, 2022 - 15:08
Time Last Modified
Friday, October 21, 2022 - 15:08