MK614217.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 33..50
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 51..81
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..32
NoneNo IPR availableTMHMMTMhelixcoord: 33..50
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..28
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 29..49
NoneNo IPR availableTMHMMTMhelixcoord: 6..28
NoneNo IPR availableCOILSCoilCoilcoord: 103..123
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 78..628
NoneNo IPR availablePANTHERPTHR31225:SF9coord: 78..628
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 28..40
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..27
NoneNo IPR availableTMHMMTMhelixcoord: 5..27
NoneNo IPR availableCOILSCoilCoilcoord: 36..40
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 32..47
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..31
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 307..573
e-value: 1.0E-99
score: 333.2
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 125..301
e-value: 9.1E-192
score: 639.9
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 88..612
e-value: 9.1E-192
score: 639.9
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 302..627
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 89..256
e-value: 5.5E-48
score: 163.2
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 86..302

  • Cannabis sativa cultivar Finola ocimene synthase mRNA
  • complete cds
Sequences
Sequence
ATGCATTATATGGCTGTTCACCAATTTGGTCCATCATTAATATCATCATC
ACTACCTTGCATTAGTACTAATAATAATCACTTAATTTGTAAATATTTCA
CACCAAAAACATCTATTAGTCCTATTTCAAAATCAAAATCAAAATCAAAA
TCAAAATCAAGTACTTGCTACCCCATCCAATGTACTGTGGTCAATAATAG
TAGCCCTAGCTCTACTACTAAATCTTCTATTGTTCGAAGATCGGCCAATT
ATGAACCTCCGATTTGGTCTTTCGATTACATTCAATCTCTTTCAACCCAA
TATAAGGGAGAATCCTATACAAGGCAATTAAATAAGTTAAAGAAAGAAGT
GAAAAGGATGCTCCTTCGAATGGAGATTAACTCTTTAGCCCTACTCGAGC
TAATCGATACATTGCAAAGGCTTGGAATATCTTATCATTTTAAGAATGAA
ATAAACACTATTTTGAAGAAAAAATACACAAATACTTATATTAACAATAA
TATTACTAACCATAATTATAATTTATACCCCATTGCTCTCGAATTTAGGC
TTCTACGCAAACATGGCTATGCAGTTCCTCAAGAAATTTTTAATATATTC
AAAGACATGAGTGGAAAATTTAAAGCAATCATAAATGATGATGATATTAT
GGGAATATTGGCGTTATATGAAGCTTCATTCTATGAGAAAAATGGTGAAA
GCATATTGGAGGAAGCTAGGGTTTTCACAACCAAGTGTCTCGAAAATTAC
ATGATGATAACAGAGGAAAACAAATTAGATGATGACGATGATCATAATAA
TATTATTGTAGTAATTAGACATGCGTTAGAGCTTCCACTTCATTGGAGGA
CTGCAAGAACGGAGGCCAAGTGGTTTATCGATGTATACGAGAAAAGACAA
GATATGAATTCTACTTTGCTTGAGTTTGCAAAACTAGATTTCAACATGGT
ACAATCAATGCATCAAGACGATCTAAAACATTTGTCTAGGTGGTGGAGTC
ATACTAAACTCGGAGAAAAACTGAATTTTGTGAGAGATAGGTTGATGGGG
TGTTTTTTATGGAATGTTGGATTAAGATTTGAGCCAGATTTCAGCTACTT
TAGGAGAATATCTGCGAGAATATATGTTCTGATTACAATAATCGATGATA
TATATGATGTTTACGGAACATTAGAAGAATTAGAGCTTTTCACTCGTGTT
GTTGAGAGATGGGATGTAAAACTACTAAAAGACTTACCAGATTATATGAA
GATGCCTTTTCTTGTTTTACACAATACCATTAATGAAATGGCACTAGATG
TATTAAAAGAAAAACACTTTGTCAACATTGAATGCCTCAAGAAAACGTGG
GGTGATATGTGTAGATCTTTTCTACAAGAGGCAAAATGGTACTATAATGG
ATACACACCAACATTTCAAGAATACATTGAAAATGGTTGGATTTCAGTAG
GAGCACCAATTATTCTTGTGCATGCTTATTTCTCTTTTGCAAATCCCATA
ACTAAAGAGGTTTTGGAAATCTTCCAACAAGGTTATCCCACAATAATTCG
TCAATCTGCCATGATCGTACGTTTGGCAAATGATCTAGCAACATCATCTG
AGGAATTCGAAAGAGGTGACTCGCCTAAATCAATTCAATGTTACATGCAA
GAACATAACGTATCTAAAGAGGAAGCTCGTGAATACATTAAGTTTTCAAT
AAGAGAAACATGGAAGGAGATGAATAGTACTTTTAATATTGAAGATGGAA
ATTCATCATTGGTTGATGATGCCAAAAACTTTGCAAGAATGGGATTATTT
ATGTATCAACATGGAGATGGACATAGTTCTCAAGATAATTTAGCAAAAGA
GCGTATTTCAAAATTCATTATCAATCCTATAGATATACACGATTCTCTTT
CTTTTTGA
Sequence Length
1908
Sequence Checksum
acbd4b7ca14dc4956a67daf21da02256
Summary
Resource Type
mRNA
Accession
MK614217.1
Organism
Name
MK614217.1
Identifier
MK614217.1
Time Accessioned
Friday, October 21, 2022 - 20:21
Time Last Modified
Friday, October 21, 2022 - 20:21