MK131290.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR036965Terpene_synth_N_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..25
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 26..95
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 28..548
NoneNo IPR availablePANTHERPTHR31225:SF99coord: 28..548
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 15..242
e-value: 1.6E-42
score: 147.3
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 26..183
e-value: 1.4E-35
score: 122.7
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 243..550
e-value: 1.1E-117
score: 394.4
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 232..545
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 235..496
e-value: 2.0E-82
score: 276.5
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 18..218

  • Cannabis sativa isolate CsTPS17CC putative sesquiterpene synthase mRNA
  • complete cds
Sequences
Sequence
ATGGCTTCTCCCTTTCTTTATGTCCCTTCTAAACACGGCAATGGATTACA
AAGTTTCACAGACCCGTTTTACATGGAGTATACACGTAATATACGAGAGA
TGAAGAACGTAATGAACAGTATTATTTTGGCTGATGATGATTATCGTGAA
CGCTCCATAGAAGCTTTGAACTTGGTCAACGCTGTGCTTAGAGTCGGCAT
TGATTATCATGTCCAAGATGAGATTAAATCTATCCTTGAAAGGGAACATA
TAATTTTCAGTGACCATATTAGTAACCAATATTTTAATAATATTAATCAA
GACCACCTGTATGAGGTTTCTCTTCGTTTCCGATTACTGAGACAAGGAGG
TTATGATGTCTCTCCAGATGTGTTTAACGAGTTGATGAAGGACAAAAAGG
GAAATTTCAATGTTTTAGTGGAAGAAGACAGAGAGGGACTAAGAGAATTG
TTTGAAGCCTCACAAGTAAGAATAGAAGGAGAAGAGGTACTAGAGGAAGC
TGAAGTGTTCAGTGGCGGACACCTAAAAGAATGGGCAAATCTTCATCGTC
ATACGAGTGAAGCTCGAAGTATTCAATTAACGCTAGACCAACCTTGTCAT
AAAAGCTTGGCCAGGGTCACATCTCCAAACTTTTTGGACAGTTTCTCGGC
CAACACTACTACCATAGACCAAGGCTGGACCTGGATGACCCTTTTAAACA
AACTGGTCACAATGGACTTCAAAATAGTACAGTCTATTCACCAAAGGGAA
ATTGTCCTTGTCTCCAAATGGTGGAAAGAGCTTGGTTTGGCAGAGGAGTT
GAAATTTGCTAGAGACCAACCCCTAAAATGGTACCTCTGGACAGTGGCAA
GTCTACCAGATCCAAGCTTGTCTGAAGAGAGGATTGAACTAACTAAACCC
ATTTCTCTCGTCTACATAATAGATGATATTTTTGATGTTTATGGGACACT
AGACGAACTCACTCTTTTCACAGACGCAGTTAATAATTGGGAAATTAAAG
AGCAGTTACCCGACTATTTGAAGATATGTTTCAAGGCACTTGATGATATA
ACCAACAAAATTAGCTACGTGGTGTACAGAAAACATGGATGGAACCCAAT
TGACTCCTTAAGAAAATCGTGGGGAAAACTGTGCAATGCGTTCTTGTTAG
AAGCAGAGTGGTTTGGTTGTGGGAAGTTGCCAAATGAAGAGGAGTATTTG
AAGAACGCGATTGTGAGTTCTGGTGTACACGTGGTGCTAGTTCATATGTT
CTTTCTCTTAGGTGAAGGTATATCCATGGAAGCTGTAAACTTACTGGACA
ACATTCCAGGCCTTGTGTCTTCTACAGCAGCAATTCTTCGTCTTTGGGAT
GACTTAGGAAGTGCCAAGGATGAGAATCAAAATGGGCATGATGGGTCTTA
CGTTGAGTGCTACATGAAAAGACACAAGGAGTGTTCAATGGGCGAAGCAA
GGGAGCAAGTGATTCGTATGATTAAAAATGAGTGGGAACGCCTCAATAAG
GAGTGTTTCTCGTCAAAACATTTTCCCATGTGCTTCAGAAAGGGTTGTCT
TAATGCTGCTAGGATGGTTCCAGTGATGTATGACTATGATGATCATCATC
GCCTTCCAGGCCTCCAGAATTATATCAACTCACTTCTCTCTCATCAAACA
ATATAA
Sequence Length
1656
Sequence Checksum
81b32f986ceb24180c347a3a952270b6
Summary
Resource Type
mRNA
Accession
MK131290.1
Organism
Name
MK131290.1
Identifier
MK131290.1
Time Accessioned
Friday, October 21, 2022 - 20:20
Time Last Modified
Friday, October 21, 2022 - 20:20