MN967483.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableCOILSCoilCoilcoord: 349..369
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 6..549
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 6..549
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..32
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..11
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 33..38
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 21..44
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 45..54
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..20
NoneNo IPR availableTMHMMTMhelixcoord: 21..43
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 228..493
e-value: 5.0E-103
score: 344.1
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 65..222
e-value: 5.2E-189
score: 630.8
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 28..533
e-value: 5.2E-189
score: 630.8
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 223..551
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 29..197
e-value: 1.2E-51
score: 175.2
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 25..223

  • Cannabis sativa cultivar Afghan Kush terpene synthase 21 mRNA
  • complete cds
Sequences
Sequence
ATGTCAAATATTCAAGTCTTAGCTTCATCTCAATTATGTGACAAAATTAT
TGCTCGTCCAACAATAAAATTTCACCCTTCTATTTGGGGGGATCGATTCC
TCCATTACAATATTTCAGAACAAGACTTGGTTTGCAAACAAGAAAGAGTT
GAAGAATTAATACAAGTTGTAAAGAAAGAGATATTGTCTTCAAATCATGA
TCAATTGAAGTTGATTGACAATCTCCAACGTTTGGGATTATCATATCATT
TCGAGAGTGAAATCGAGAAATTATTGGAACAATTAAGTACTGGCATTCAT
CATCAAAATAATAATCTACATGATGTTTCTCTTCGGTTTAGACTATTAAG
ACAAAGTGGATTTAAGGTTTCATCAACCATATTTGAAAAATTCAAAGACG
AGAAAGGTAACTTTAAAGAAAGCCTAATAACCGATGTTCCAGGTTTGCTT
AGCTTGTATGAGGCTTCGCACTTGAGTTATGTTGGAGAAAGCATACTAGA
TGAAGCACTTGCTTTCACAACCACTCACCTTAAGGCTATTGTGGCAAATA
GTAAAAATCATCCATTATCACATCAAATATCCATAGCCTTGGAAAGGCCT
CTAAGAAAGACCATAGAGAGGCTTCATGCTAGGTTTTACATCTCAATCTA
TGAAAAGGATGCCTCTCATAACAAACTATTGCTAGAGCTTGCAAAGTTAG
ACTTCAATGTACTTCAATGTTTCCACAAAAAGGAACTTAGTGAAATTATG
AGGTGGTGGAAGGAGCATGAGTTTGTAAAGAAATTCCCTTTTGCAAGAGA
TAGGATGGTGGAACTATATTTTTGGATATTGGGTGTATATTATGAACCCA
AATACTCTCGAGCAAGAAAGCTTTTGACCAAAGTCATTGCATTGACCTCA
ATCACTGATGATACTTATGATGCATATGGTACTATTGATGAGCTTGAGCT
TCTTACCAAAGCAATTCAAAGGTGGGACATAAATTGTATGGATAAACTTG
AGCCAGAATATTTAAAGACATATTATAAGGTAATGTTGGATTCTTATGAA
GAATTTGAAAAGGAGCTTAAAAAGGAAGAATTATACAAACTCGAGTATGC
AAAAGAAGAGATGAAAAGAACTATTGGAGGTTATTTTGAAGAAGCTCGAT
GGTTGAATGAAGGATATTTCCCAAGCTTCGATGAGCATTTGAGAGTTTCA
TATGTTTCTTCTGCTAACGTTTTGTTGATAGCCACAAGTTTTGTAGGAAT
GCATGATATTGTAACACATGAAACTCTAGATTGGCTCTCCAAACACCCTA
ACATTGTTTCAGCTTCCACTCTCCTCTCAAGATTCATGGATGACATAGGC
TCTCGCAAGTTTGAGCAAGAGAGAAATCACATACCATCTACAGTGGATTG
TTACATGAAACAATATGGAGTATCAGAAGAAGAGGCAATTAAAGAACTTA
ATAAAAGAGTGATCACCCACTGGAAAGAAATTAATGAAGACTTTATTAGG
CCAACTGTTGTGCCTTTTCCTATCTTAGTTCGTGTTCTTAATTTTACAAA
AGTAATAGATCTTTTTTACAAAGAGGGTGATGATCAATACACACGTGTTG
GAAAAGCGCTCAAAGAAAGCATTGATGCTTTGCTTATAGATTCAATCCCA
TTATAA
Sequence Length
1656
Sequence Checksum
ec78a63e5fd3b103c4866e53790286e9
Summary
Resource Type
mRNA
Accession
MN967483.1
Organism
Name
MN967483.1
Identifier
MN967483.1
Time Accessioned
Friday, October 21, 2022 - 20:20
Time Last Modified
Friday, October 21, 2022 - 20:20