MN967482.2

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR001906Terpene_synth_N

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 21..44
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 45..54
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..20
NoneNo IPR availableTMHMMTMhelixcoord: 21..43
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 6..548
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 6..548
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..32
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..11
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 33..38
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 47..196
e-value: 3.0E-49
score: 167.3
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 65..221
e-value: 1.2E-185
score: 619.7
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 28..532
e-value: 1.2E-185
score: 619.7
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 222..550
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 227..492
e-value: 1.4E-102
score: 342.6
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 25..222

  • Cannabis sativa cultivar Purple Kush terpene synthase 28 mRNA
  • complete cds
Sequences
Sequence
ATGTCAAATATTCAAGTCTTAGCTTCATCTCAATTATGTGACAAAATTAT
TGCTCGTCCAACAATAAAATTTCACCCTTCTATTTGGGGGGATCCATTCC
TCCATTACAATATTTCAGAACAAGACTTGGTTTGCAAACAAGAAAGAGTT
GAAGAATTAATACAAGTTGTAAAGAAAGAGATATTGTCTTCAAATCATGA
TCAATTGAAGTTGATTGACAATCTCCAACGTTTGGGATTATCATATCATT
TCGAGAGTGAAATCGAGAAATTGGAACAATTAAGTACTGGCATTCATCAT
CAAAATAATAATCTACATGATGTTTCTCTTCGGTTTAGACTATTAAGACA
AAGTGGATTTAAGGTTTCATCAACCATATTTGAAAAATTCAAAGACGAGA
AAGGTAACTTTAAAGAAAGCCTAATAACCGATGTTCCAGGTTTGCTTAGC
TTGTATGAGGCTTCGCACTTGAGTTATGTTGGAGAAAGCATACTAGATGA
AGCACTTGCTTTCACAACCACTCACCTTAAGGCTATTGTGGCAAATAGTA
AAAATCATCCATTATCACATCAAATATCCATAGCCTTGGAAAGGCCTCTA
AGAAAGACCATAGAGAGGCTTCATGCTAGGTTTTACATCTCAATCTATGA
AAAGGATGCCTCTCATAACAAACTATCGCTAGAGCTTGCAAAGTTAGACT
TCAATGTACTTCAATGTTTCCACAAAAAGGAACTTAGTGAAATTCTGAGG
TGGTGGAAGGAGCATGAGTTTGTAAAGAAATTCCCTTTTGCAAGAGATAG
GATGGTGGAACTATATTTTTGGATATTGGGTGTATATTATGAACCCAAAT
ACTCTCGAGCAAGAAAGCTTTTGACCAAAGTCATTGCATTGACCTCAATC
ACTGATGATACTTATGATGCATATGGTACTATTGATGAGCTTGAGCTTCT
TACCAAAGCAATTCAAAGGTGGGACATAAATTGTATGGATAAACTTGAGC
CAGAATATTTAAAGACATATTATAAGGTAATGTTGGATTCTTATGAAGAA
TTTGAAAAGGAGCTTAAAAAGGAACAATTATACAAACTCGAGTATGCAAA
AGAAGAGATGAAAAGAACTATTGGAGGTTATTTTGAAGAAGCTCGATGGT
TGAATGAAGGATATTTCCCAAGCTTCGATGAGCATTTGAGAGTTTCATAT
GTTTCTTCTGCTAACGTTTTGTTGATAGCCACAAGTTTTGTAGGAATGCA
TGATATTGTAACACATGAAACTCTAGATTGGCTCTCCAAACACCCTAACA
TTGTTTCAGCTTCCACTCTCCTCTCAAGATTCATGGATGACATAGGCTCT
CGCAAGTTTGAGCAAGAGAGAAATCACATACCATCTACAGTGGATTGTTA
CATGAAACAATATGGAGTATCAGAAGAAGAGGCAATTAAAGAACTTAATA
AAAGAGTGATCACCCACTGGAAAGAAATTAATGAAGACTTTATTAGGCCA
ACTGTTGTGCCTTTTCCTATCTTAGTTCGTGTTCTTAATTTTACAAAAGT
AATAGATCTTTTTTACAAAGAGGGTGATGATCAATACACACGTGTTGGAA
AAGCGCTCAAAGAAAGCATTGATGCTTTGCTTATAGATTCAATCCCATTA
ATCTTTCTAGAAGATCTCCTACAATATTCTCAGCTGCCATGGAAAATCGA
TGTTCTTCTTTTATTCTCTCAAGATTTTCAGGCTGTATATTAA
Sequence Length
1743
Sequence Checksum
bc82c3df6562d015d3cf9c8cfe0d0ccf
Summary
Resource Type
mRNA
Accession
MN967482.2
Organism
Name
MN967482.2
Identifier
MN967482.2
Time Accessioned
Thursday, October 20, 2022 - 11:25
Time Last Modified
Thursday, October 20, 2022 - 11:25