MN967481.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR005630Terpene_synthase_metal-bd

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 249..515
e-value: 3.9E-98
score: 328.0
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 29..215
e-value: 2.0E-49
score: 167.9
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 28..553
e-value: 4.3E-197
score: 657.5
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 245..573
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 65..243
e-value: 4.3E-197
score: 657.5
NoneNo IPR availablePANTHERPTHR31225:SF9coord: 18..573
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 18..573
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 26..238

  • Cannabis sativa cultivar Purple Kush terpene synthase 5 mRNA
  • complete cds
Sequences
Sequence
ATGATTACAGGACTAATCTCCACTACTACTTTCAAAGAACAACCAGCAAT
AGTCCGTCGATCAGGAAACTACAAACCCCCATTGTGGGATGCTCATTTTA
TCCAATCACTCCAAGTCATATATACGGAGGAAAGCTATGGGAAAAGAATC
AATGAGCTGAAAGAAGATGTGAGAAGAATTCTTGAGAAGGAGGCTGAAAA
TCCTTTAGTTAAGCTTGAACAGATTAATGATTTGAGCAGACTTGGAATAT
CTTATCACTTTGAAGATCAAATTAAGGCAATATTAAACCTGACATATAAT
AATAATAATGCATTGTGGAAGAAAGATAATCTGTATGCCACTGCTCTTCA
TTTCAAACTCCTTAGACAATATGGATTCAATCCTGTATCTTCAGAGGTTT
TCAATGCTTTCAAAGACGAGAAAAAGGAGTTCAAAGAGAGTTTGAGTAAG
GATGTGAAAGGAATGGTATGTCTATATGAGGCTTCATTCTATTCATTTAG
GGGTGAACCCATATTAGATGAAGCAAGAGATTTCACAACAAAACATCTCA
AACAATACTTGATGATGACGAGGCAAGGTAAAACTATATCTGTTGACCAT
GATGATAATAATGATTTAATGGTGAAATTAGTGGAGCATGCTTTGGAGCT
TCCAGTGCATTGGAGAATGAAAAGGTTGGAGGCAAGGTGGTTTATTGATA
TGTATGCTGAAATGTCTCATCATCATCATATGAATTCAACTTTTCTTCAA
CTTGCTAAACTAGATTTTAACGTTGTACAATCAACATACCAAGAAGACCT
TAAACATGCTGTAAGGTGGTGGAAAACTACTAGTCTAGGAGAAAGGTTAC
CCTTTGCAAGAGATAGGATAGTTGAAACGTTCTTATGGAGTGTGGGAGTT
AAATTTGAGCCACAGTTTAGATATTGCCGAAAAATGCTCACAAAGATGGG
TCAATTGGTAACCTCAATGGACGATATATTTGACGTGTATGGTACGCTTG
ATGAGCTAAGCCTCTTTCAAGACGCATTGGAAAGGTGGGATATAAATACG
ATAGACCAACTTCCAGATTACATGAAGATATTTTTTTTGGCTGCTTATAA
TGTGGTGAATGAAATGGCGTATGACGTGCTAAAACAAAATGGGATTCTCA
TTATCAAATATTTAAAGAAAACGTGGACGGATTTATGTAAATGTTACATG
TTGGAGGCAAATTGGTATCATAGTGGATACACACCAAGCTTGGAAGAATA
CATTAAAAATGGATGGATATCAATTGCAGAACCCTTAATTCTAGTCAATC
TTTATTGCCTTATAACCAATCCAATAAAAGAAGATGACATGGACTGCTTG
CTTCAATATCCCACCTTTATTCGTATCTCAGGAATCATTGCTCGACTTGT
TGATGATTTAGGAACTTCATCGGATGAACTGAAAAGAGGAGACAATCCTA
AATCGATTCAATGCTATATGAAAGAAAATGGTATTTGTGATGAAAAGAAT
GGCCGTGAACACATAAGGAATTTAATCAGTGAAACATGGAAGGAAATGAA
TGAAGCTCGAGTGGGTGAGTCTCCATTTTCTCAAGCTTTTATTGAAACTG
CCATAGATTTCGTTAGGACAGCAATGATGATATACCAAAAGGAGCAAGAT
GGGGTTGGTACTAATTTTGATCATTACACAAAAGATGGAATCATTTCCTT
GTTCTTCACTTCCATTCCATTTGAACCATATTAA
Sequence Length
1734
Sequence Checksum
975aafc41ad58debee77fef051c5af06
Summary
Resource Type
mRNA
Accession
MN967481.1
Organism
Name
MN967481.1
Identifier
MN967481.1
Time Accessioned
Friday, October 21, 2022 - 20:19
Time Last Modified
Friday, October 21, 2022 - 20:19