MN967480.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 42..42
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..22
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 23..41
NoneNo IPR availableCOILSCoilCoilcoord: 36..40
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..28
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 29..49
NoneNo IPR availableTMHMMTMhelixcoord: 6..28
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..26
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 27..44
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 45..75
NoneNo IPR availableTMHMMTMhelixcoord: 27..44
NoneNo IPR availableCOILSCoilCoilcoord: 108..128
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 83..633
NoneNo IPR availablePANTHERPTHR31225:SF9coord: 83..633
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 28..40
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..27
NoneNo IPR availableTMHMMTMhelixcoord: 5..27
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 32..47
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..31
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 312..578
e-value: 5.8E-99
score: 330.8
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 130..306
e-value: 7.6E-192
score: 640.2
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 93..617
e-value: 7.6E-192
score: 640.2
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 307..632
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 94..261
e-value: 1.1E-48
score: 165.4
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 91..307

  • Cannabis sativa cultivar Chocolope terpene synthase 23 mRNA
  • complete cds
Sequences
Sequence
ATGTATATATATAATTACAAAAAAAAAAAAAAAATGCATTATATGGCTGT
TCACCAATTTGGTCCATCAATAATATCATCATCACTACCTTGCATTAGTA
CTAATAATAATCACTTAATTTGTAAATATTTCACACCAAAAACATCTATT
AGTCCTATTTCAAAATCAAAATCAAGTACTTGCTACCCCATCCAATGTAC
TGTGGTCAATAATAGTAGCCCTAGCTCTACTACTAAATTTTCTATTGTTC
GAAGATCGGCAAATTATGAACCTCCGATTTGGTCTTTCGATTACATTCAA
TCTCTTTCAACCCAATATAAGGGAGAATCCTATACAAGGCAATTAAATAA
GTTAAAGAAAGAAGTGAAAAGGATGCTCCTTCGAATGGAAGTTAACTCTT
TAGCCCTACTCGAGTTAATCGATACATTGCAAAGGCTTGGAATATCTTAT
CATTTTAAGAATGAAATAAACACTATTTTGAAGAAAAAATACACAAATAC
TTATATTAACAATAATATTACTAACCATAATTATAATTTATACCCCATTG
CTCTCGAATTTAGGCTTCTACGCCAACATGGCTATGCAGTTCCTCAAGAA
ATTTTTAATATTTTCAAAGACGTGAGTGGAAAATTTAAAGCAATCATAAA
TGACGATGATATTATGGGAATATTGGCGTTATATGAAGCTTCATTCTATG
AGAAAAATGGTGAAAGCATATTGGAGGAAGCTAGGGTTTTCACAACCAAG
TGTCTCGAAAATTACATGATGATAACGGAGGAAAACAAATTAGATGATGA
TGATGATCGTAATAATATTATTGTAGTAATTAGACATGCGTTAGAGCTTC
CACTTCATTGGAGGACTGCAAGAACGGAGGCCAAGTGGTTTATCGATGTA
TACGAGAAAAGACAAGATATGAATTCTACTTTGCTTGAGTTTGCAAAACT
AGATTTCAACATGGTACAATCAATGCATCAAGACGATCTAAAACATTTGT
CTAGGTGGTGGAGTCATACTAAACTCGGAGAAAAACTGAATTTTGTGAGA
GATAGGTTGATGGGGTGTTTTTTATGGAATGTTGGATTAAGATTTGAGCC
AGATTTCAGCTACTTTAGGAGAATATCTGCAAGAATATATGTTCTTATTA
CAATAATCGATGATATATATGATGTTTACGGAACATTAGAAGAATTAGAG
CTTTTCACTCGTGTTGTTGAGAGATGGGATGTAAAACTACTAAAAGACTT
ACCAGATTATATGAAGATGCCTTTTCTTGTTTTACACAATACCATTAATG
AAATGGCATTAGATGTATTAAAAGAAAAACACTTTGTCAACATTGAATGC
CTCAAGAAAACGTGGGTTGATATGTGTAGATCTTTTCTACAAGAGGCAAA
ATGGTACTATAATGGATACACACCAACATTTCAAGAATACATTGAAAATG
GTTGGATTTCAGTAGGAGCACCAGTTATTCTTGTGCATGCTTATTTCTCT
TTTGCAAATCCCATAACTAAAGAGGTTTTGGAAATCTTCCAACAAGGTTA
TCCCACAATAATTCGTCAATCTGCCATGATCGTACGTTTGGCAAATGATC
TAGCAACATCATCTGAGGAATTCGAAAGAGGTGACTCGCCTAAATCAATT
CAATGTTACATGCAAGACCATAATGTATCTAAAGAGGAAGCTCATGAATA
CATTAAGTTTTCAATAAGAGAAACATGGAAGGAGATGAATAGTACTTTTA
ATATTGAAGATGGAAATTCATCATTGGTTGATGATGCCAAAAACTTTGCA
AGAATGGGATTATTTATGTATCAACATGGAGATGGACATAGTTCTCAAGA
TAATTTAGCAAAAGAGCGTATTTCGAAATTCATTATCAATCCTATAGATA
TACACGATTTTCTTTCTTTTTGA
Sequence Length
1923
Sequence Checksum
f587b991ea365bde01a68c34442d576f
Summary
Resource Type
mRNA
Accession
MN967480.1
Organism
Name
MN967480.1
Identifier
MN967480.1
Time Accessioned
Friday, October 21, 2022 - 20:19
Time Last Modified
Friday, October 21, 2022 - 20:19