MN967477.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR001906Terpene_synth_N

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..30
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..11
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 31..41
NoneNo IPR availableCOILSCoilCoilcoord: 350..370
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 5..550
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 5..550
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..13
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 36..60
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 14..35
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..19
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 20..39
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 40..41
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 29..198
e-value: 2.9E-52
score: 177.2
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 229..494
e-value: 5.2E-104
score: 347.3
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 65..223
e-value: 1.9E-192
score: 642.1
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 28..534
e-value: 1.9E-192
score: 642.1
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 224..550
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 25..224

  • Cannabis sativa cultivar Purple Kush terpene synthase 22 mRNA
  • complete cds
Sequences
Sequence
ATGTCAAATATTCAAGTCTTAGCTTCATCTCAATTAAGTGACAAAATTAT
TGCTCGTCCAACAACAAATTTTCACCCTTCTATTTGGGGCGATCGATTCC
TCCATTACAATGTTTCAGAACAAGACTTGGTTTGCAAACAAGAAAGAATT
GAAGAATTAATACAAGTTGTGAAGAAAGAGATATTATCTTCAAATCATGA
TCAATTGAAGTTGATTGACAATCTCCAACGTTTGGGATTATCACATCATT
TTGAGAGTGAAATTGAGAAATTGTTGGAACAATTAAGTATCGGCACTCAT
CATCAAAATCATCAAGATCTACATGATGCTTCTCTTTGGTTTAGATTATT
AAGACAACATGGATTTAATGTTTCATCAAGTATATTTGAAAAATTTAAAG
ACGATGAAGGTAACTTTAAGAAAAGCTTGATAACCGACGTTTCGGGTTTA
CTTAGTTTGTATGAGGCTTCACACTTGAGTTATGTTGGAGAAAGCATACT
AGATGAAGCACTTGCTTTCACAACCACTCACCTTAAGGCTATTGTGGCAA
ATAGTAAAGATCATCCATTATCACATCAAATATCCAAAGCCTTGGAAAGG
CCACTAAGAATGACCTTAGAGAGGCTTCATGCTAGGTTTTATATCTCAAT
CTATGAAAAGGATGCCTCTCATAACAAAGTATTGCTAGAGCTTGCAAAGT
TAGACTTCAATCTACTTCAATGTTTCCACAAAAAGGAGCTTAGTGAAATT
GTGAGGTGGTGGAAGGAGCATGAGTTTGCAAAGAAATTCCCTTTTGCAAG
AGATAGGATTGTGGAACTGTATTTTTGGATATTGGGTGTATATTATGAAC
CCAAATACTCTAGAGCAAGAAAACTTCTAACCAAAGTCATTGCATTGACC
TCAATCACAGATGATATTTATGATGCATATGGTACTATTGATGAGCTTCA
GCTTCTTACCAAAGCAATGCAGAGGTGGGACATAAATTGTATGGATAAAC
TTGAGCCAGAATATTTGAAGACATATTATAAGGTAATGTTGGAATCTTAT
GAAGAATTTGAAAAGGAGCTTAAAAAGGAAGAATTATACAAACTTGAGTA
TGCAAAAGAAGAGATGAAAAGAATTATTGGAGCTTATTTTGAAGAAGCTC
GATGGTTAAATGAAGGATATTTGCCAAGCTTCGATGAGCATTTGAGAGTC
TCTTATATTTCTTCTGGTTACGTTTTGTTGATAGCCACAAGTTATGTAGG
AATGCATGATATTGTAACACATGAAACTCTAAATTGGCTCTCCAAAGACC
CTAAGATTGTTTCAGCTTCTACTCTCCTCTCAAGATTCATGGATGACATA
GGCTCTCGCAAGTTTGAACAAGAGAGAAATCACGTACTATCTACAGTGGA
ATGTTACATGAAGCAATATGAGGTTTCAGAGGAAGAAGCAATTAAAGAAC
TTAATAAAAGAGTGGCCAATTGTTGGAAAGAAATAAATGAAGACTTTATT
AGACCAACTAGTGTGCCTTTTCCTATTTTATTTCGTATTATTAATTTGAC
CAAGACAGCTGATTTTATGTACAGAGAAGGTGGTGACCAATATACACATG
TTGGAAAGGTGTTGAAAGATAGCATTGCTGCTTTACTTATAGATCCAATC
ATCTTTCTAGAAGATCTCCTACAATATTCTCAGCTGCCATGGAAAATCGA
TGTTCTTCTTTTATTCTCTCAAGATTTTCAGTGA
Sequence Length
1734
Sequence Checksum
e0d30990d3b3410f3c3ab326ec213dda
Summary
Resource Type
mRNA
Accession
MN967477.1
Organism
Name
MN967477.1
Identifier
MN967477.1
Time Accessioned
Friday, October 21, 2022 - 20:18
Time Last Modified
Friday, October 21, 2022 - 20:18