MN967474.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR005630Terpene_synthase_metal-bd

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 256..521
e-value: 3.3E-94
score: 315.2
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 40..224
e-value: 3.9E-48
score: 163.7
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 76..250
e-value: 8.3E-190
score: 633.4
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 39..561
e-value: 8.3E-190
score: 633.4
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 251..577
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 29..578
NoneNo IPR availablePANTHERPTHR31225:SF9coord: 29..578
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 36..247

  • Cannabis sativa cultivar Purple Kush terpene synthase 31 mRNA
  • complete cds
Sequences
Sequence
ATGGGAGAGCGGCCGCCAGATCTTCCGGATGGCTCGAGTTTTTCAGCAAG
ATATCCAATATTCAAAGATCAACCAGCAGCAATTGTCCGGCGATCAGGCA
ACTACAAACCCACATTGTGGGATGCTCATTTTTTCAATTCACTCCAAGTC
ATATATACGGAGGAAAGCTATGGGAAAAGAATCAATGAGCTGAAAGAAGA
TGTGAGAAGAATTCTTGAGAAGGAGGCTGAAAATCCTTTAGTTAAGCTTG
AACAGATCAATGATTTGAGCAGACTTGGAATATCTTATCACTTTGAAAAT
CAAATTAAAACAATATTAAACCTGACATTTAACAATAATAATGCATTGTG
GAAGAAAGATAATCTGTATGCCACTGCTCTTCATTTCAAACTCCTTAGAC
AATATGGATTCAGTCCTGTATCTTCAGAGGTTTTCAATGTCTTCAAAGAC
GAGAAAAATGAGTTCAAGGAGAATTTAAGTAAGGATGTGAAAGGAATGGT
ATGTCTATATGAGGCTTCATTCTATTCATTTAGGGGTGAACCCATATTAG
ATGAAGCAAGAGATTTCACAACCAAACATCTCAAACAATACTTGATGACG
AGGCAATGTCAAACTAAATCTGTTGACCATGATGATGATGATGATCTTGT
GAAACTTGTGGAGCATGCCTTGGATCTTCCACTCCATTGGAGATTGCCAA
GATTGGAGGCTAGGTGGTTTATTGATATGTATGCTGAAAGGAATTATGAT
ATGAATCCAACTTTTCTTGACTTTGCTAAACTTGACTATAACTTCGTTCA
GTCAGCATACCAAAAAGAGCTCAAATATATTTCAAGGTGGTGGAGTGGTT
CTAGATTGACAGAAAGGCTACCATTTGCTAGAGACAGAGTAGTGGAAATT
TTCTATTCTGCAGTGGCACTAAAATATGAGGCAGAATTTGGGTTTGTTAG
AACTGTGATGACAAAAATTGGTCTCTTGCTAACACTCATGGACGATATAT
ATGATGTGTATGGTACACTAGATGAGCTTCAGCTTTTTCTAGAGGCAATT
GAGAGGTGGAATATAAATGAACTGGATCAGCTACCCGATTACATGAAGAT
ATTGTTTGTTGCTTTTTATAACAATGTGAATGAGATATCTTATTATGTCC
TCAAAGAAAATGGGATTCACACCATCAAATATCTAAAGAAAGCGTTGGGT
GATCTGTGTAAATGCTATATGGAGGAGGCAAAATGGTTTCACAGTGGACA
CATACCAAGTTTAGAAGAATTCATTGAGAATGGATGGAAATCAATTACAA
TACCTCTTTGTCTTATCTATCATTATTGCTTAATTACAACTTCAATTACA
GAACAAGACATGGAACACTTGCTTCAATATCCAACCATTTTACGTGTCTC
AGGAACTGTTTTTCGATTTATAGATGACTTGGGAACCTCATCAGATGAAC
TTGAAAGAGGAGATAATCCTTCATCAATTCAATGCTACATGCGTGAAAAG
GGTGTTAGTGAAAATGAAAGCCGTGAACACATATGGAATTTAATAAGTGA
AGGATGGAAAGAAATTAATGAAGTTAAAGCTTCAACCTCTCCATACTCTC
AAGTGTTTATTGAATCTGCCATTGATTTTGTTAGAGGAGCAATGGAGATG
TACCACAAGGGTGATGGTTTTGGTACTAATCAAGATCGGTATCTTAAGAC
CAAAGTTGTCAACATGTTCTTCGATCCAATTCCAATTTAA
Sequence Length
1740
Sequence Checksum
cbe2b11399c6d8a15a69032eac3a823a
Summary
Resource Type
mRNA
Accession
MN967474.1
Organism
Name
MN967474.1
Identifier
MN967474.1
Time Accessioned
Friday, October 21, 2022 - 20:18
Time Last Modified
Friday, October 21, 2022 - 20:18