MN967472.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR036965Terpene_synth_N_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 48..58
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..28
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 29..47
NoneNo IPR availableTMHMMTMhelixcoord: 29..48
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..19
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 20..39
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 40..57
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 5..550
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 5..550
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 139..163
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 92..111
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 120..138
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..91
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 112..119
NoneNo IPR availableTMHMMTMhelixcoord: 121..138
NoneNo IPR availableTMHMMTMhelixcoord: 92..114
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 65..222
e-value: 6.6E-187
score: 623.9
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 228..494
e-value: 3.2E-101
score: 338.2
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 28..534
e-value: 6.6E-187
score: 623.9
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 223..551
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 29..197
e-value: 2.4E-50
score: 170.9
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 25..223

  • Cannabis sativa cultivar Lemon Skunk terpene synthase 25 mRNA
  • complete cds
Sequences
Sequence
ATGTCAAATATTCAAGTCTTAGCTTCATCTCAATTAAGTGACAAAATTGT
TTCTCGCCCAACAACAAAATTTCACCCTTCTATTTGGGGCGATCGATTCC
TCCATTACAATATTTCAGAACAAGACTTGGTTTGCAAACAAGAAAGAATT
GAAGAATTAATACAAGTTGTGAAGAAAGAGATATTATCTTCAAATCATGA
TCAATTGAAGTTGATTGACAACCTCCAACGTTTGGGATTATCACATCATT
TTGAGAGTGAAATCGAGAAATTATTAGAACAATTAAGTATCGGCACTCAT
CATCAAAATAATAATCTACATGATGTTTCTCTTTGGTTTAGACTATTAAG
ACAAAGTGGATTTAAGGTTTCATCAAGCGTATTTGAAAAATTCAAAGACG
AGAAAGGTAACTTTAAAGAAAGCCTAATAACTCATGTTCCAGGTTTGCTT
AGCCTGTACGAGGCTTCGCACTTGAGTTATGTTGGAGAAAGCATACTAGA
TGAAGCACTTGCTTTCACAACCACTCACCTTAAGGCTATTGTGGCAAATA
GTAAAGATCATCCATTATCACATCAAATATCCATAGCCCTGCATAGGCCT
CTAAGAAAGACCATAGAGAGGCTTCATGCTAGGTTTTATATTTCAATCTA
TGAAAAGGATGCCTCTCATGACAAAGTATTGTTAGAGCTTGCAAAGTTAG
ATTTTAATCTATTACAATGTTTCCACAAAAAGGAGCTTAGTGAAATTGTC
AGGTGGTGGAAGGAGCATGAGTTTGCAAAGAAATTTCCTTTTGCAAGAGA
TAGGATTGTGGAACTGTATTTTTGGATATTGGGTGTATATTATGAACCCA
AATACTCTCAAGCAAGAAAGCTTTTAACCAAAGTCATTGCATTGACCTCA
ATCACTGATGATATATATGATGCATATGGTACTATTGATGAGCTTGAGAT
TCTTACCCAAGCAATGCAGAGGTGGGACATAAGTTATATAGATAAACTTG
AACCAGAATATTTGAAGACATATTATAAGGCAATGTTGGATTCTTATGAA
GAGTTTGAAAAAGAGCTTAAAAAGAAAGAAATATACAAACTTGAGTATGC
AAAAGAAGAGATGAAAAGAATGATTAGAGCTTATTTTGAAGAAGCTAGAT
GGTTGAACCAAAAATATTTCCCAAGCTTGGATGAACATTTGAGAGTTTCT
TATGTTACTAATTGTGGTAACATTATGCTGATAGCCACAAGTTTTGTTGG
AATGGATGATATTGTAACAAATCAAACTCTTCAATGGCTCTCCAATGACC
CTAAAATTGTAAAAGCTTCCACTCTCCTTTCTAGACACATGAATGATATA
GCTTCTCGAAAGTTTGAGCAAGAGAGAAACCACATACCATCAACAGTGGA
ATGTTACATGAAGCAATACGGGGTATCAGAAGAAGAGGCAGTTGAAGAAC
TCAATAAAAGAGTTGTCAATTACTGGAAAGAAATCAATGAAGATTTTATT
AGGCCGACTGCTGTGCCTTTACCTATCTTAATTCGTGTTCTTAATTTTAC
TAAGGTAGCTGAGCTTATTTACAAAGAGGGTGATGATCAATATACACATG
TTGGAAAAGTATTGAAAAAAAGCATTGCTGCTTTACTTATAGACCCAATC
CCATAA
Sequence Length
1656
Sequence Checksum
9b3858b3d268d0544070a8f5d2be0111
Summary
Resource Type
mRNA
Accession
MN967472.1
Organism
Name
MN967472.1
Identifier
MN967472.1
Time Accessioned
Friday, October 21, 2022 - 20:17
Time Last Modified
Friday, October 21, 2022 - 20:17