MN967471.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..30
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 31..41
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..11
NoneNo IPR availableTMHMMTMhelixcoord: 12..34
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 60..609
NoneNo IPR availablePANTHERPTHR31225:SF9coord: 60..609
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 40..40
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 17..39
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..16
NoneNo IPR availableTMHMMTMhelixcoord: 17..39
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 3..13
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 19..44
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..18
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 14..18
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..2
NoneNo IPR availableSIGNALP_EUKSignalP-noTMSignalP-noTMcoord: 1..18
score: 0.693
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..32
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 33..49
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 70..594
e-value: 4.4E-190
score: 634.4
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 281..610
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 71..228
e-value: 1.3E-46
score: 158.7
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 285..552
e-value: 6.5E-97
score: 324.0
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 107..279
e-value: 4.4E-190
score: 634.4
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 68..280

  • Cannabis sativa cultivar Purple Kush terpene synthase 36 mRNA
  • complete cds
Sequences
Sequence
ATGCAATGCTTGGCTGTTCCATCATCATCACCAGTCCCAGTTAGACTAAT
TACACCAAAAAAATGTACTAATTATAATTATAATTTTGTTAGTAGTACTA
CAAGATCAAGATTATCAAGATCAAGTGCTTGCTACCCCATTCAATGTACT
GTAGTCGATAGTTCTAATCCAATTATCGATCGACGATCGGGCAACTATGA
ACCATCCATTTGGTCTTTTGATTATATTCAGTCTCTTACAAGCCAATATG
AGAGAGAACCTTATAGAAGTCGGGTGAAAGAGATCGAGGGAGATGTGAAA
AGGATGCTAGTTGAGATGGAAAACTCTTTAGCTCAACTTGAGCTCATTGA
CACATTGCAAAGACTTGGAGTATCTTATCGCTTTGAGAATGAAATAAGTA
CTATTTTGAAGGAAAAATATGCCAATGTTAATAACCCTAATTATAATTTA
TACGCCATTGCTCTTGAATTTAGACTTCTACGTCAACATGGTTATGCAGT
ACCTCAAGAGATTTTTAATCATTTTAAGGATGAGACAGGAAAATTCAAGG
CAAACATAATTAGTGATGATATTATGGGAGTATTGGCCTTATACGAAGCT
TCATTCTATGAGAAAAAAGGCGAAAGTATTTTAGAGGAAGCTAGAATTTT
TACAACTAAATATCTCGAAAACTACACTATAATGATATCGCAAGAAAAGA
AATTAATGATTGATAATGATTATGATTATGATTATAATTTCGAAGTAGTG
AATCATGCATTAGAGCTCCCACTTCATTGGAGGACTACAAGAATAGAAGC
TAAGTGGTTCATCGACGCGTATGAGAAAAAACAAGACATGAATCCTATTT
TGCTTGAATTTGCTAAACTCGATTTCAACATGATACAATCAACACATCAT
GACGATCTAAAACATATATTCAGGTGGTGGAGGCATACTAAACTTGGGGA
GAAATTGAATTTTGCAAGAGATCGATTGATGGAATGTTTCTTATGGAAGG
TTGGAGTAAGATTTGAGCCAAAATTCAGTTATTTTAGAAAAACAACTGCC
AAATTATATGAGCTAATAACATTAATTGATGATATATATGATGTTTATGG
AACATTGGATGAATTAGAGCTTTTCACCAAAGCTGTTGAGAGATGGGATG
TGACAATGATAAATGAGTTACCAGAATACATGAAGATGCCTTTTCTTGTT
TTACACAATACAATAAATGAAATAGTATTTGAGATATTAAGAGACAAAGA
CATCTCCATCAACATTCAATACCTTAAGAAAACGTGGATAGATATGTGTA
GAGGTTTTCTACAAGAAGCAAAATGGTACTATAGTGGATACACACCAACA
TTGGAAGAATATATAGAAAATGGTTGGATCTCAGTGGGAGCACCAGTTCT
TATTGTGCATGCTTATTTTTCTCATTCAAATAATAATAAAGAGATTTTCG
AATGCTTGGAACATAGTTATTATCCTACCATAATTCATCATTGTGCCATA
ATATTACGACTTTCAAATGATCTAGCAACATCATCTGAGGAACTGGAGAG
AGGTGATGCTCCAGCATCAATTCAATGTTACATGCAAGAAAAAAATGTAT
CTGAAAAGGAAGCTCGTGAACATATTAAGGTTTTAATAAGTGAAGCATGG
AAGGAGATGAATAACAGTGAATCTGATGATGGATTAATATATCCAATCTC
ATTGATTGAAGATGCCAAAAACTTTGCTAGGATGGGATTATTCATGTATC
AACATGGTGATGGTCACAGTTCTCAGGATAATCGATCCAAAGAAAGAATT
TCATCCTTGATTATTAAACCTATTCCCATAGATACTTAA
Sequence Length
1839
Sequence Checksum
d56f65d89b76b5e9d6ea5e904d6671e3
Summary
Resource Type
mRNA
Accession
MN967471.1
Organism
Name
MN967471.1
Identifier
MN967471.1
Time Accessioned
Friday, October 21, 2022 - 08:29
Time Last Modified
Friday, October 21, 2022 - 08:29