MN967470.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR036965Terpene_synth_N_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..25
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 19..25
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 8..18
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..7
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 26..46
NoneNo IPR availableSIGNALP_EUKSignalP-noTMSignalP-noTMcoord: 1..25
score: 0.601
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..30
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 31..46
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..11
NoneNo IPR availableTMHMMTMhelixcoord: 13..35
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 54..63
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..34
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 35..53
NoneNo IPR availableTMHMMTMhelixcoord: 27..49
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..36
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 37..53
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 40..40
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 17..39
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..16
NoneNo IPR availableTMHMMTMhelixcoord: 17..39
NoneNo IPR availableCOILSCoilCoilcoord: 50..74
NoneNo IPR availablePANTHERPTHR31225:SF74TRICYCLENE SYNTHASE, CHLOROPLASTICcoord: 8..570
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 8..570
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 65..240
e-value: 4.0E-189
score: 631.2
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 28..189
e-value: 1.5E-48
score: 165.0
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 246..513
e-value: 1.4E-95
score: 319.7
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 28..554
e-value: 4.0E-189
score: 631.2
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 242..571
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 26..241

  • Cannabis sativa cultivar Afghan Kush terpene synthase 17 mRNA
  • complete cds
Sequences
Sequence
ATGGATTGCATATCAGGCAAAATCCCTAGTGATAGTTCTGTTACTAATAT
TGTTCGAAGATCAGCCAACTTTGAACCATCCATTTGGTCTTTTGATTTCA
TTCAGTCTCTTTCAAGCAAATATAAGGGAGAACCTTATATAAGTCGAGTA
AAAAAGCTCGAGGAAGATGTGAAAAGGATGCTAGTTGAGATGGAAAACTC
TTTAGCTCAACTTGAACTCATTGACACGTTACAAAGACTTGGAGTATCTT
ATCGTTTTGAGAATGAAATAAATACTATTTTAAAAGAAAAATATGTCAAT
ATTAATGGTAATATTAATAACCCTAATTATAATTTATATGCCACTGCTCT
TGAATTTAGGCTTCTACGTCAACATGGTTATGCTGTACCTCAAGAGACTT
TTAATTATTTTAAGGACGAGACAGGAAAATTCAAAACAAACATAAGTGGT
GATATCATGGGAGTATTGGCCTTATATGAAGCTTCATTCTATGAGAAAAA
AGGCGAAAGCATTTTAGAGGAAGCTAGAATTTTCACAACTGAACGTCTCA
AAAACTACACAATAATGATATCAGAGCAAAAGAAATTGATGATTAATAAT
AATTATGATTATTATTACAATATTGAATTAGTGAATCATGCTTTGGAGCT
CCCACTTCATCGAAGGACCACAAGAATAGAAGCTAAGTGGTTCATCGATA
TGTACAAGAAAAAACAAGACATGAATCCTATTTTGCTTGAGTTTGCCAAA
CTCGATTTCAACATGATACAATCAACACATCATGAAGATTTGAAACATAT
ATTCAGGTGGTGGAGGCATACTAAACTTGGTGAGAAATTGAATTTTGCAA
GAGATCGATTGATGGAATGTTTTTTATGGAAAGTTGGAATAAGATTTGAG
CCAAAATTCAGTTATTTTAGAACAACAACTGTCAAATTACTTGAGCTAAT
AACATTAATTGATGATATATATGATGTTTATGGAACATTAGATGAATTAG
AGCTTTTCACCAAAGCTATTGAGAGATGGGATGTGGAAATGATAAATGAA
TTACCAGAATACATGAAGATGCCTTATATTGTTTTACACAATACAATAAA
TGAAATGGTATTTGAGATATTAAGAGATCAACAAATCACCATCAAAATTC
AATACTTAAAGAAAACGTGGGTAGATATGTGTAGATGTTTTCTACAAGAA
GCAAAATGGTACTACAGTGGATACACACCAACATTGGAAGAATATATTGA
AAATGGTTGGATTTCAGTGGGAGCACCAGTTCTTATTGTGCATGCTTATT
TTTCTCATTCAAATAATAATAAAGAGATTTTTGAATGCTTGGAACATGGT
TATTATCCTACCATAATTCGTCACAGTGCCATAATAATACGACTTACAAA
TGACCTAGCAACATCATCTGAGGAACTGAAAAGAGGTGATGCTCCGACGT
CAATTCAATGTTACATGCAAGAAAAAAATATATGTGAAGAGGAATCTCGT
GAACATATTAAGTTTTTAATAAGTGAAGCGTGGAAGGAGATGAATATCAG
TGAATCTGATGATGGATTAATATATCCAATCTCATTGATTGAAGATGCGA
GAAACTTTGCTAGGATAGGATTATTCATGTATCAACATGGTGATGGTCAC
AGTTCTCAGGATAATCTATCCAAAGAAAGAATTTCATCCTTTATTATTAA
ACCTATTCCCCTATAG
Sequence Length
1716
Sequence Checksum
33884b74cc9c65c1de05d3bd93d38385
Summary
Resource Type
mRNA
Accession
MN967470.1
Organism
Name
MN967470.1
Identifier
MN967470.1
Time Accessioned
Friday, October 21, 2022 - 20:17
Time Last Modified
Friday, October 21, 2022 - 20:17