CsCBDAs

Annotations
This record has the following annotations.
TermNameDefinition
GO:0071949FAD bindingInteracting selectively and non-covalently with the oxidized form, FAD, of flavin-adenine dinucleotide, the coenzyme or the prosthetic group of various flavoprotein oxidoreductase enzymes. [GOC:mah]
GO:0050660flavin adenine dinucleotide binding
GO:0055114oxidation-reduction processA metabolic process that results in the removal or addition of one or more electrons to or from a substance, with or without the concomitant removal or addition of a proton or protons. [GOC:dhl, GOC:ecd, GOC:jh2, GOC:jid, GOC:mlg, GOC:rph]
GO:0016491oxidoreductase activity
INTERPRO:IPR036318FAD-bd_PCMH-like_sf
INTERPRO:IPR016166FAD-bd_PCMH
INTERPRO:IPR012951BBE
INTERPRO:IPR016167FAD-bd_PCMH_sub1
INTERPRO:IPR006094Oxid_FAD_bind_N

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableGENE3D3.40.462.20coord: 176..398
e-value: 3.9E-165
score: 551.8
NoneNo IPR availableGENE3D3.30.465.50coord: 62..461
e-value: 3.9E-165
score: 551.8
NoneNo IPR availablePANTHERPTHR32448FAMILY NOT NAMEDcoord: 2..462
NoneNo IPR availablePANTHERPTHR32448:SF60BERBERINE BRIDGE ENZYME-LIKE 18coord: 2..462
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..27
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 40..44
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 45..52
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 28..39
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..44
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..20
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 40..40
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 21..39
NoneNo IPR availableTMHMMTMhelixcoord: 21..39
IPR006094FAD linked oxidase, N-terminalPFAMPF01565FAD_binding_4coord: 3..139
e-value: 5.9E-24
score: 84.4
IPR016167FAD-binding, type PCMH, subdomain 1GENE3D3.30.43.10coord: 1..57
e-value: 9.4E-25
score: 88.5
IPR012951Berberine/berberine-likePFAMPF08031BBEcoord: 402..460
e-value: 6.0E-24
score: 83.9
IPR016166FAD-binding domain, PCMH-typePROSITEPS51387FAD_PCMHcoord: 1..173
score: 17.844
IPR036318FAD-binding, type PCMH-like superfamilySUPERFAMILY56176FAD-binding/transporter-associated domain-likecoord: 2..174

CsCBDAs
Sequences
Sequence
CCCAAAACCACTTGTTATCATCACTCCTTTAAATGTCTCCCATATCCAAG
GCACTATTCTATGCTCCAAGAAAGTTGGCTTGCAGATTCGAACTCGAAGC
GGTGGTCATGATGCTGAGGGCATGTCCTACATATCTCAAGTCCCATTTGT
TATAGTAGACTTGAGAAACATGCATTCGGTCAAAATAGATGTTCATAGCC
AAACTGCATGGGTTGAAGCCGGAGCTACCCTTGGAGAAGTTTATTATTGG
ATCAATGAGAACAATGAGAATCTTAGTTTTCCTGCTGGGTACTGCCCTAC
TGTTGGCGCGGGTGGACACTTTAGTGGAGGAGGCTATGGAGCATTGATGC
GAAATTATGGCCTCGCGGCTGATAATATCATTGATGCGCACTTAGTCAAT
GTTGATGGAAAAGTTTTAGATCGAAAATCCATGGGGGAAGATTTGTTTTG
GGCTATACGTGGTGGTGGAGGAGAAAACTTTGGAATCATTGCAGCGTGGA
AAATTAGACTTGTTGCTGTCCCATCAATGTCTACTATATTCAGTGTTAAA
AAGAACATGGAGATACATGAGCTTGTCAAGTTAGTTAACAAATGGCAAAA
TATTGCTTACATGTATGAAAAAGAATTATTACTCTTTACTCACTTTATAA
CCAGGAATATTACAGATAATCAAGGGAAGAATAAGACAACAATACACAGT
TACTTCTCCTCCATTTTCCATGGTGGAGTGGATAGTCTAGTCGACTTGAT
GAACAAGAGCTTTCCTGAATTGGGTATTAAAAAAACAGATTGCAAACAGT
TGAGCTGGATTGATACTATCATCTTCTACAGTGGTGTTGTAAATTACAAC
ACAACTTATTTTAAAAAAGAAATTTTGCTTGATAGATCAGGTGGGCGGAA
GGCGGCTTTCTCGATTAAGTTAGACTATGTTAAGAAACCGATTCCAGAAA
CCGCAATGGTCACAATTTTGGAAAAATTATATGAAGAAGATGTAGGAGTT
GGGATGTTTGTGTTTTACCCTTATGGTGGTATAATGGATGAGATTTCAGA
ATCAGCAATTCCATTCCCTCATCGAGCTGGAATCATGTATGAAATTTGGT
ACATAGCTTCATGGGAGAAGCAAGAAGATAATGAAAAGCATATAAACTGG
ATTCGGAATGTTTATAATTTCACGACTCCTTATGTGTCCCAAAATCCAAG
AATGGCGTATCTCAATTATAGGGACCTTGATTTAGGAAAAACTAATTTCG
AGAGTCCTAATAATTACACACAAGCACGTATTTGGGGTGAAAAGTATTTT
GGTAAAAATTTTAATAGGTTAGTAAAAGTAAAAACCAAGGTTGATCCCGA
TAATTTCTTTAGAAACGAACAAAGCATCCCACCTCTTC
Sequence Length
1388
Sequence Checksum
0c3600c20923ad33bd9e4471eccedfff
Summary
Resource Type
mRNA
Organism
Name
CsCBDAs
Identifier
CsCBDAs
Time Accessioned
Friday, October 21, 2022 - 20:16
Time Last Modified
Friday, October 21, 2022 - 20:16