TPS7_Finola

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 70..86
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..51
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 52..69
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..13
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 36..60
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 14..35
NoneNo IPR availableCOILSCoilCoilcoord: 349..369
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 3..549
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 3..549
NoneNo IPR availableTMHMMTMhelixcoord: 15..37
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 228..493
e-value: 3.0E-104
score: 348.1
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 64..222
e-value: 2.0E-192
score: 642.1
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 28..197
e-value: 8.1E-52
score: 175.7
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 27..534
e-value: 2.0E-192
score: 642.1
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 223..551
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 24..223

TPS7_Finola
Sequences
Sequence
ATGTCTAGTCAAGTGTTAGCTTCATCTCAATTAAGTGACAAAATTATTGC
TCGTCCAACAACAAATTTTCACCCTTCTATTTGGGGCGATCGATTCCTCC
ATTACAATGTTTCAGAACAAGACTTGGTTTGCAAACAAGAAAGAATTGAA
GAATTAATACAAGTTGTAAAGAAAGAGATATTATCTTCAAATCATGATCA
ATTGAAGTTGATTGACAATCTCCAACGTTTGGGATTATCACATCATTTTG
AGAGTGAAATTGAGAAATTGTTGGAACAATTAAGTATCGGCACTCATCAT
CAAAATCATCAAGATCTACATGATGCTTCTCTTTGGTTTAGATTATTAAG
ACAACATGGACTTAATGTTTCATCAAGTATATTTGAAAAATTTAAAGACG
ATGAAGGTAACTTTAAGAAAAGCTTGATAACCGACGTTTCGGGTTTACTT
AGTTTGTATGAGGCTTCACACTTGAGTTATGTTGGAGAAAGCATACTAGA
TGAAGCACTTGCTTTCACAACCACTCACCTTAAGTCTATTGTGGCAAATA
GTAAAAATCATCCATTATCACATCAAATATCCAAAGCCTTGGAAAGGCCA
CTAAGAATGACCTTAGAGAGGCTTCATGCTAGGTTTTATATCTCAATCTA
TGAAAAGGATGCCTCTCATAACAAAGTATTGCTAGAGCTTGCAAAGTTAG
ACTTCAATCTACTTCAATGTTTCCACAAAAAGGAGCTTAGTGAAATTGTG
AGGTGGTGGAAGGAGCATGAGTTTGCAAAGAAATTCCCTTTTGCAAGAGA
TAGGATGGTGGAACTGTATTTTTGGATATTGGGTGTTTATTATGAACCCA
AATACTCTCGAGCAAGAAAACTTCTAACCAAAGTCATTGCATTGACCTCA
ATCACTGATGATATTTATGATGCATATGGTACTATTGATGAGCTTCAGCT
TCTTACCAAAGCAATGCAGAGGTGGGACATAAATTGTATGGATAAACTTG
AGCCAGAATATTTGAAGACATATTATAAGGTAATGTTGGAATCTTATGAA
GAATTTGAAAAGGAGCTTAAAAAGGAAGAATTATACAAACTTGAGTATGC
AAAAGAAGAGATGAAAAGAATTATTAGAGCTTATTTTGAAGAAGCTCGAT
GGTTAAATGAAGGATATTTGCCAAGCTTCGATGAGCATTTGAGAGTCTCT
TATATTTCTTCTGGTTACGTTTTGTTGATAGCCACAAGTTATGTAGGAAT
GGATGATATTGTAACACATGAAACTCTAAATTGGCTCTCCAAAGACCCTA
AGATTGTTTCAGCTTCTACTCTCCTCTCAAGATTCATGGATGACATAGGC
TCTCGCAAGTTTGAACAAGAGAGAAATCACGTACTATCTACAGTGGAATG
TTACATGAAGCAATATGAGGTTTCAGAGGAAGAAGCAGTTAAAGAACTTA
ATAAAAGAGTGGCCAATTGTTGGAAAGAAATAAATGAAGACTTTATTAGG
CCAACTAGTGTGCCTTTTCCTATTTTATTTCGTATTATTAATTTGACCAA
AACAGCTGATTTTATGTACAGAGAAGGTGGTGACCAATATACACATGTTG
GAAAGATGTTGAAAGATAGCATTGCTGCTTTACTTATAGATCCCATCCCA
TTATAG
Sequence Length
1656
Sequence Checksum
b14b64c41e6384b56f4313cdd296599c
Summary
Resource Type
mRNA
Organism
Name
TPS7_Finola
Identifier
TPS7_Finola
Time Accessioned
Friday, October 21, 2022 - 20:16
Time Last Modified
Friday, October 21, 2022 - 20:16