TPS41

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..30
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 31..41
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..11
NoneNo IPR availableTMHMMTMhelixcoord: 12..34
NoneNo IPR availablePANTHERPTHR31225:SF74TRICYCLENE SYNTHASE, CHLOROPLASTICcoord: 3..130
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 3..130
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 35..393
NoneNo IPR availablePANTHERPTHR31225:SF9coord: 35..393
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 3..13
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 19..44
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..18
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 14..18
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..2
NoneNo IPR availableSIGNALP_EUKSignalP-noTMSignalP-noTMcoord: 1..18
score: 0.693
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..24
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 25..49
NoneNo IPR availableTMHMMTMhelixcoord: 10..29
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..35
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 36..54
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 55..55
NoneNo IPR availablePANTHERPTHR31225:SF74TRICYCLENE SYNTHASE, CHLOROPLASTICcoord: 1..54
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 1..54
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..25
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 26..49
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 3..74
e-value: 3.0E-19
score: 69.4
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 258..387
e-value: 2.7E-51
score: 174.5
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 1..51
e-value: 1.1E-15
score: 57.8
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 1..130
e-value: 1.8E-41
score: 144.1
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 3..130
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 45..390
e-value: 1.3E-128
score: 431.5
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 254..390
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 1..57
e-value: 6.9E-20
score: 73.1
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 1..52
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 82..252
e-value: 1.3E-128
score: 431.5
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 46..205
e-value: 3.4E-45
score: 154.1
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 43..253

TPS41
Sequences
Sequence
AATTATAATTTTGTTAGTAGTACTACAAGATCAAGATTATCAAGATCAAG
TGCTTGCTACCCCATTCAATGTACTGTAGTCGATAGTTCTAATCCAATGA
TCGATCGACGATCGGGCAACTATGAACCATCCATTTGGTCTTTTGATTAT
ATTCAGTCTCTTACAAGCCAATATGAGGGAGAACCTTATAGAAGTCGGGT
GAAAGAGATCGAGGGAGATGTGAAAAGGATGCTAGTTGAGATGGAAAATT
CTTTAGCTCAACTTGAGCTCATTGACACATTGCAAAGACTTGGAGTATCT
TATCGCTTTGAGAATGAAATAAGTACTATTTTGAAGGAAAAATATGTCAA
TGTTAATAACCCTAATTATAATTTATACGCCATTGCTCTTGAATTTAGAC
TTCTACGTCAACATGGTTATGCAGTACCTCAAGAGATTTTTAATCATTTT
AAGGACGAGACAGGAAAATTCAAGGCAAACATAATTAGTGATGATATTAT
GGGAGTATTGGCCTTATATGAAGCTTCATTCTATGAGAAAAAAGGCGAAA
GTATTTTAGAGGAAGCTAGAATTTTCATAAAAAAATATCTCGAAGACTAC
ACTATAATGATATCGCAAGAAAAGAAATTAATGATTGATAATGATTATGA
TTATAATTTCGAAGTAGTGAATCATGCATTAGAGCTCCCACTTCATTGGA
GGACTACAAGAATAGAAGCTAAGTGGTTCATCGACGCGTATGAGAAAAAA
CAAGACATGAATCCTATTTTGCTTGAATTTGCTAAACTCGATTTCAACAT
GATACAATCAACACATCATGATGATCTAAAACATATATTCAGGTGGTGGA
GGCATACTAAACTTGGGGAGAAATTGAATTTTGCAAGAGATCGATTGATG
GAATGTTTCTTATGGAAGGTTGGAGTAAGATTTGAGCCAAAATTCAGTTA
TTTTAGAAAAACAACTGCCAAATTATATGAGCTAATAACATTAATTGATG
ATATATATGATGTTTATGGAACATTGGATGAATTAGAGCTTTTCACCAAA
GCTGTTGAGAGATGGGATGTGACAATGATAAATGAGTTACCAGAATACAT
GAAGATGCCTTTTCTTGTTTTACACAATACAATAAATGAAATAGTATTTG
AGATATTAAGAGACAAAGACATCTCCATCAACATTCAATAACTTAAGAAA
ACGTGGATAGATATGTGTAGAGGTTTTCTACAAGAAGCAAAATGGTACTA
TAGTGGATACACACCAACATTGGAAGAATATATAGAAAATGGTTGGATCT
CAGTGGGAGCACCAGTTCTTATTGTGCATGCTTATTTTTCTCATTCAAAT
AATAATAAACTTGTCTAAGTTTCAGATGAAGAAGTGGAATGTCTTAAAGA
GGGTTATCCCAATATTGTTCGACATGGATCCCTAATATTACGACTTGCAG
ATGATCTAGGAACATGTTCGGATGAAATGAAAAGAGGCGATGTTCCTACA
TCAATTCAATGTTACATGCATGATACTGGTGTTTCTGAAGACGAAGCTCG
TGAGCACATCAAGCATTTGATAAGCGAATCATGGAAGGAGATGAATAATG
AAAATGGAGATCATAATTCTTCTTTCTCGAAAGAATTTGTTCATGTTTGC
AAAAATCTTGGTAGAGCGTCACAATTTATATACCAATATGGAGATGGACA
TGCTTCTCAAAATACTCTATCAAAAGATCGTATTTTTAAAATTATTATTA
ATCCTTTCCCC
Sequence Length
1761
Sequence Checksum
6f984e0b29aaae35ec95242153c28b02
Summary
Resource Type
mRNA
Organism
Name
TPS41
Identifier
TPS41
Time Accessioned
Friday, October 21, 2022 - 20:15
Time Last Modified
Friday, October 21, 2022 - 20:15