TPS6-like

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR001906Terpene_synth_N

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 8..18
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 28..74
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..7
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 19..27
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..27
NoneNo IPR availableSIGNALP_EUKSignalP-noTMSignalP-noTMcoord: 1..27
score: 0.646
NoneNo IPR availableSIGNALP_EUKSignalP-noTMSignalP-noTMcoord: 1..23
score: 0.475
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..23
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 24..43
NoneNo IPR availableTMHMMTMhelixcoord: 4..23
NoneNo IPR availableCOILSCoilCoilcoord: 75..95
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 43..592
NoneNo IPR availablePANTHERPTHR31225:SF9coord: 43..592
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 40..40
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 17..39
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..16
NoneNo IPR availableTMHMMTMhelixcoord: 17..39
NoneNo IPR availableTMHMMTMhelixcoord: 11..33
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 54..211
e-value: 8.3E-45
score: 152.8
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 266..539
e-value: 8.2E-96
score: 320.4
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 276..593
e-value: 1.0E-115
score: 388.0
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 261..591
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 54..275
e-value: 2.7E-66
score: 225.2
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 51..261

TPS6-like
Sequences
Sequence
GTATTTTTTAGACCAAAAGTATATACTAATTATAATATTATTAATAATAA
TGCTACAAAATCAAGATTATCAAGTGCATGCTACCCCATCCAATGTGCTG
TGGTCAATAGTTCTAATGCAATTATTGATCGACGATCTGCCAACTTTGAG
CCCTCCATTTGGTCTTTTGATTATATTCAATCTCTTACAAGTCAATATAA
GGGAGAACCTTATACAAGTCGAGTGAAAAAACTTGAGAGAGATGTGAAAA
AGATGTTAGTTGAGATGGAAAACTCTTTAGCTCAACTTGAACTCATTGAT
ACATTGCAAAGACTTGGAATATCTTACCGTTTTGAGAATGAAATAAATTC
TATTTTGAACAAAAAATATGTTAATATTAATAATCCTAATTATAATTTAT
ATGCCATTGCTCTTCAATTTAGGCTTCTACGTCAACATGGCTATGCAGTA
CCTCAAGAGATTTTTAATCAGTTGAAGGACGAGATAGAAAACATCAAAAA
ACACATAAATGGTAATGATATCATGGGAGTATTAGCCTTATACGAAGCTT
CTTTTTATGAGAAAAAAGGCGAAAGTATTTTAAAGGAAGCTAGAATTTTC
ACAACTAAATGTCTCAAAAACTACACTATAATGATATCAGAGCAAAAAAA
GTTAATGATTGATAATGATTATGATTATGATATCGAAGTAGTGAATCATG
CCTTAGAGCTCCCACTTCATCGGAGGACCACAAGAACAGAAGCAAAGTGG
TTCATTGACGCATATGCGAAAAAACAAGACATGAATCCTATGTTGCTTGA
GTTAGCCAAACTCGATTTCAACATAGTACAATCAACACATCATGAAGATC
TAAAACATATATTCAGGTGGTGGAGACATACTAAACTTGGAGAGAAATTG
AATTTTGCAAGAGATCGATTGATGGAATGTTTCTTATGGAATATTGGAAT
AAGATTTGAGTCAAAATTCAGCTATTTTAGAACAAAAACTGCCAAATTAT
TTGAGCTAGTAACATTTATAGATGATATATATGATGTTTATGGAACATTG
GATGAATTAGAGCTTTTCACCAAAGCTGTTGAGAGATGGGATGTGAAAAT
GATAAATGAGTTACCAGAATACATGAAGATGCCTTATCTTGTTTTACACA
ATACCATAAATGATATGGTATTTGAGGTGTTAAGAGACCAAGAAATTTCC
ATCAACATTCAATACCTTAAGAAAACGTGGGTCGATATGTGTAAAAGTTT
CTTGCAAGAGGCAAAATGGTACTATAGTGGATACACACCAACATTGGAAG
AATATATTGAAAATGGTTGGATTTCAGTAGGAGCACCAGTTATTCTTGTG
CATGCTTATTTTTTTCACGCAAATAATAATCGTACAATTACAAATACTAA
AGAGATTTTCGAATGCTTGGAATATGGTTATTATCCTGCCATTATTCGTC
ACAGTGCCATAATATTACGATTTACAAATGACCTAGCAACATCATCGGAG
GAATTGAAAAGAGGTGATGCTCCGACATCAATTCAATGTTACATGCAAGA
AAAAAATGTATCTGAAGAGGAAGCTCGTGAACATGTTAAGTTTTTAATAA
ATGAAGCATGGAAGGAGATGAATAATGATGTTGGATTATATCCAATCTCA
TTGACTGAAGATGCTACAAACTTTGCTAAGATGGGATTTTTCATATATCA
ACATGGTGATGGTCATAGTTCTCAAGATAATCAATCCAAACAAAAAATTT
CATCCTTGATTATTGAACCTATTCCCCTATATACA
Sequence Length
1785
Sequence Checksum
11e4f6e2bc245ef83d4d14d210736336
Summary
Resource Type
mRNA
Organism
Name
TPS6-like
Identifier
TPS6-like
Time Accessioned
Friday, October 21, 2022 - 20:15
Time Last Modified
Friday, October 21, 2022 - 20:15