TPS12-like

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 14..52
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..13
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..1
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 9..13
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 2..8
NoneNo IPR availableSIGNALP_EUKSignalP-noTMSignalP-noTMcoord: 1..17
score: 0.689
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 10..566
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 10..566
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..20
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 21..45
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 46..48
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..24
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 25..46
NoneNo IPR availableTMHMMTMhelixcoord: 4..21
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 8..18
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..7
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..23
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 19..23
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 24..75
NoneNo IPR availableSIGNALP_EUKSignalP-noTMSignalP-noTMcoord: 1..20
score: 0.759
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 12..16
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 17..55
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..3
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 4..11
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..16
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 245..511
e-value: 4.0E-97
score: 324.8
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 66..239
e-value: 3.1E-182
score: 608.5
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 29..214
e-value: 1.6E-54
score: 184.5
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 29..550
e-value: 3.1E-182
score: 608.5
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 240..566
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 26..240

TPS12-like
Sequences
Sequence
ATGTCCACTCAAATCTTAGCATCATCATCTTCAAATGACAACCCAAATAA
AATTGTTCGTCCTACAAAAACATTTCATCCACATATTTGGGGAGAACGAT
TCTTACATTACAACATTTCACAACAAGATTTGTATTGTCAACAACAAAAG
GTTGAGGAATTAAAGGAAGTGGTTAGAAGAGAAATATTTGGAGAATCATC
AATATCATCATCAGCTTATTATGATGCTTGGAAAAATCAATTGAAGATAA
TTGATGTGGTAGAACGTTTGGGATTGTCTTATCATTTTGAAACTGAAATA
GAAAATAAGCTTCAATGCATTTACAACAAAACCAATATTGATGATGAAGA
TTTACACCATGTTTCTTTACGGTTTAGACTTCTACGACAACATGGATTTA
GAATTTCTTCGGATATATTTGAAAAATTCAAAGACGAGGATGGGAACTTT
AAAAAATGCTTGGTAAGTGATACCCTTGGTTTGCTTAGCTTATATGAGGC
TACACATTTGAGTTGTGTTGGAGAAAATATACTTGATGAAGCACTTGCTT
TCACAACAACACACTTAACCGAGTTTTTGGCAAAGAAAAAAGAATACCAT
GATGACGATGATCCATTATCAAAAGAAATATCTCGAGCCCTAGAGAGGCC
CTTAAGAAAGACCCTAGTGAATCTTCATGCAAGGCATTTCATTTCGATAT
ATGAAAAAGATGATTCACATAACAAAGTATTGTTACAACTTGCAAAATTA
GATTTCAATCTATTACAATGCATGCACAAAAAGGAGCTTTGTGAAGTCAG
CAGGTGGTGGAAAGAATCAGATTTTGTACACAAATTTCCATTTGCAAGAG
ATAGGATTGTGGAATTGTACCTTTGGATATTAGGAGTTTATTATGAACCA
CAATACTGTTTGGCAAGAAATATTTTACTCAAAATCATAGCTTTGGCCTC
AATTGCTGATGATATTTATGATGCATATGGTACATTTGAAGAACTTGAGA
TCCTAACTCATGCAATTGAAAGGTGGGATATAAATTGTGTGGATAAACTG
AATCAAGAATATATGCAAACATTTTATAAGGATGTTTTGAATTGTTATGA
AGAGTTTGAGCAAGTGCTAGAAAAAGAAGAACAATACAAAGTTCATTATG
CAAAAGAAGCGTTTAAGGGATTAGTCCGATCTCATTTGGATGAAGCTCGA
TGTTTGCATAGAGGACTCATCCCAAGTTTTGAAGAGTACTTGAAATTTGC
TTTGGATAATTGTGGTTACTACATGTTGATACTAAGCTCTTTGGTTGGAA
TGAAAACTAATATTGTAACAAAAGAAGTTTTTGAGTGGCTCTCGAAAGAT
CGAAAGATTATTAGAGCATCTGTTACTATTTGTAGGCTCATGGATGACAT
AGCTGAACACAAGTTTGAGGAAGATGATTATGAGGAACATTCAGCAGTGG
AATGCTATATGATTGAACATGGCGTTTGTGAAGAGGAAGCCTATGATGAA
CTGAATAAGCTAATAATGAATGCATGGAAAGAAATAAATGAAGAGTTTTT
GAAGCCTACTAAAGTAGCTTCACCTATATTACTTCGTGCTCTTAACTTTT
CAAGGGTTATGGATCTTATTTTCAAATTTGGAGATGGTTATACACACGTT
GGAAAAATCACCAAAGATATTGTTGCTGCTTTGCTTATTCATCCAATT
Sequence Length
1698
Sequence Checksum
4203349498a865ff06e9608a81a50c46
Summary
Resource Type
mRNA
Organism
Name
TPS12-like
Identifier
TPS12-like
Time Accessioned
Thursday, October 20, 2022 - 10:42
Time Last Modified
Thursday, October 20, 2022 - 10:42