TPS8-like

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR036965Terpene_synth_N_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..19
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 20..39
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 40..41
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 21..44
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 45..54
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..20
NoneNo IPR availableTMHMMTMhelixcoord: 21..43
NoneNo IPR availableCOILSCoilCoilcoord: 350..370
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 5..550
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 5..550
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 65..223
e-value: 6.6E-191
score: 637.1
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 29..198
e-value: 4.6E-51
score: 173.2
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 28..534
e-value: 6.6E-191
score: 637.1
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 224..552
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 229..494
e-value: 8.0E-104
score: 346.7
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 25..224

TPS8-like
Sequences
Sequence
ATGTCAAATATTCAAGTCTTAGCTTCATTTCAATTAAGTGACAAAATTAT
TGCTCGTCCAACAACAAATTTTCACCCTTCTATTTGGGGCGATCGATTCC
TCCATTACAATGTTTCAGAACAAGACTTGGTTTGCAAACAAGAAAGAATT
GAAGAATTAATACAAGTTGTGAAGAAAGAGATATTATCTTCAAATCATGA
TCAATTGAAGTTGATTGACAATCTCCAACGTTTGGGATTATCACATCATT
TTGAGAGTGAAATTGAGAAATTGTTGGAACAATTAAGTATCGGCACTCAT
CATCAAAATCATCAAGATCTACATGATGCTTCTCTTTGGTTTAGATTATT
AAGACAACATGGATTTAATGTTTCATCAAGTATATTTGAAAAATTTAAAG
ACGATGAAGGTAACTTTAAGAAAAGCTTGATAACCGATGTTTCGGGTTTA
CTTAGCTTGTATGAGGCTTCACACTTGAGTTATGTTGGAGAAAGCATACT
AGATGAAGCACTTGCTTTCACAACCACTCACCTCAAGGCTATTGTGGCAA
ATAGTAAAGATCATCTATTATCACATCAAATATCCATAGCCTTGGAAAGG
CCTCTAAGAAAGACCATAGAGAGGCTTCATGCTAGGTTTTACATCTCAAT
CTATGAAAAGGATGCCTCTCATAACAAACTATTGCTAGAGCTTGCAAAGT
TAGACTTCAATCTACTTCAATGTTTCCACAAAAAGGAACTTAGTGAAATT
ACGAGGTGGTGGAAGGAGCATGAGTTTGCAAAGAAATTCCCTTTTGCAAG
AGATAGGATTGTGGAACTGTATTTTTGGATATTGGGTGTATATTATGAAC
CCAAATACTCTCGAGCAAGAAAACTTCTAACCAAAGTCATTGCATTAGCC
TCAATCACAGATGATATTTATGATGCATATGGTACTATTGATGAGCTTCA
ACTTCTTACCAAAGCAATTCAAAGGTGGGACATAAATTGTCTGGATAAAC
TTGAGCCAGAATATTTAAAGACATATTATAAGGTAATGTTGGATTCTTAT
GAAGAATTTGAAAAGGAGCTTAAAAAAGAAGAATTATACAAACTTGAGTA
TGCAAAAGAAGAGATGAAAAGAATTATTGGAGCTTATTTTGAAGAAGCTC
GATGGTTGAGTGAAGGATATTTCCCAAGCTTGGATGAGCATTTGAGAGTT
TCATATGTTTCTTGTGGTTACGTTTTGTTGATAGCCACAAGTTATGTAGG
AATGTATGATATTGTAACACATGAAACTCTAAATTGGCTCTCCAAAGACC
CTAAAATTGTTTCAGCTTCCACTCTACTTGCTAGGTTCATGGATGATATT
GGTTCTCGCAAGTTTGAGCAAAAGAGAAATCACATACCATCTACAGTAGA
TTGTTACATGAAACAATATGGGGTATCAGAGAAAGAGGCAATTAAAGAAC
TTAATAAAAGAGTGGACACCCACTGGAAAGAAATTAATGAAGACTTTATT
AGGCCAACTGTTGTGCCTTTTCCTATCTTAGTTCGTGTTCTTAATTTTAC
AAAAATAGTTGATCTTCTTTACAAAGAGGGCGATGATCAATACACAAATG
TTGGAAAAGTGCTCAAAGAAAGCATTGCTGCTTTGCTTATAGATTCAATC
CCATTA
Sequence Length
1656
Sequence Checksum
1b0709de17fdd633b7254d2409adc267
Summary
Resource Type
mRNA
Organism
Name
TPS8-like
Identifier
TPS8-like
Time Accessioned
Friday, October 21, 2022 - 20:14
Time Last Modified
Friday, October 21, 2022 - 20:14