TPS43

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..26
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 27..41
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 1..487
NoneNo IPR availablePANTHERPTHR31225:SF98coord: 1..487
NoneNo IPR availableSIGNALP_EUKSignalP-noTMSignalP-noTMcoord: 1..16
score: 0.666
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 34..53
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 54..66
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..33
NoneNo IPR availableTMHMMTMhelixcoord: 34..56
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 21..38
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..20
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 39..39
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 3..487
e-value: 8.1E-176
score: 587.3
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 180..486
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 14..151
e-value: 8.0E-41
score: 139.8
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 182..451
e-value: 2.1E-94
score: 315.8
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 14..176
e-value: 8.1E-176
score: 587.3
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 5..175

TPS43
Sequences
Sequence
CAAGAGTTGAAGCAAGTTACGAGTACTTCACTTAGAACCACAAAAGACCC
TTGTATTCTCTTGAAGCTTATTGATTCTATCCAAAGGTTGGGACTCGAAT
ATCACTTCGAAAATGAGATTGAAGAAGCTGTTTCTTTCATTTACGCACAT
AATGATCAAACTACTAGTAATGATCTCTTCATGACAGCACTTAGATTTCG
TATTCTTAGGCAACATGGCTTATTTGTTGGCTCAGATGTGTTTGACAGAT
TTAGAGGCAGAGATGGGAAATTCTTGGACAGCTTAAGCAGTAACAAGCAT
GGAATTTTGAGTTTGTATGAAGCTTCACACCTTGGAATGGCTGAAGAAAA
TGTTTTGGAGGAAGCCAAGAGTTTCACCACCAAAAGGCTAAGATATTTCT
CAGCTGGGAAAATGGATAATACTTTGTTTGGTAAGCAAGTGAAACAATCA
CTGGAAGTTCCACTGTATTGGAGGATGCCAAGATCTGAAGCTAGGAATTT
CATTGATCTCTACCAAATGGATGAGACAAAGAGTGTGACTTTGCTTGAGT
TGGCTAAGTTGGATTATAATCTGGTCCAATCTGTGCATCAAAATGAGCTT
AAGGAGTTGGGAAGGTGGTGGGAAAATTTGGGATTCAAGAAAAATCTACC
TTTTGCAAGAGATCGTGTGGTGGAGAACTATTTGTGGGCCATGGGAATCG
TATCTGAGCCACAGTTCTCCAAATGCAGGATAGGCTTAACCAAGTTCGTT
TGCATATTAACAGCAATAGATGATGTTTATGACATATATGGATCATTAGA
TGAGCTTGAACTTTTCACAAATGCAGTAGAAAGCTGGGACATAAGGGCAA
TAAGGGATGAATTTCCTCTTTATTTGAAAACATGCTATCTTGGCATGCTT
AATTTTGGTAATGAAGTGATCGATGATGTTCTTCAAAACCATGGCTTGAA
TATTTCCTCCTACATTAAAGAAGAGTGGTTAAATCTCTGCAAATCATATC
TTGTAGAAGCAAGGTGGTTTTATAATGATTATACACCAAGTTTGAATGAA
TACTTGGAAAATTCATCTACTTCAGTTGGTGGTCATGCAGCTATAGTTCA
TGCTTGTATTTTACTCTTAGATGGCTCCATACCCGAAACCTTACTGGATT
ACAATTTCAACCATTTTCACTCTAAGCTGATTTATTGGTCATCTCTTATA
ACAAGGCTTAGTGATGATTTAGGAACTTCAAAGGATGAGCTTAAAAGAGG
AGATGTGAAGAAATCAGTGGAGTGCTACATGGCAGAGAAAGGAATATGGG
AAGAAGAAGAAGCAATAAATCACATAAAAGAATTGAGAAGAAATTCATGG
AAAATGGTGAACAAGGAGATAATAATTGGGAATAATTGCCTGCCAAAAAT
AATGGTGAAGATGTGCTTGAACATGGCAAGAACTGCTCAATTCATATTCC
AACATGGTGAT
Sequence Length
1461
Sequence Checksum
67c9cfa79ed4dc3d057632d565159209
Summary
Resource Type
mRNA
Organism
Name
TPS43
Identifier
TPS43
Time Accessioned
Friday, October 21, 2022 - 20:14
Time Last Modified
Friday, October 21, 2022 - 20:14