TPS4-like

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR001906Terpene_synth_N

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 30..213
e-value: 3.1E-54
score: 183.6
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 68..238
e-value: 1.1E-184
score: 616.6
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 29..550
e-value: 1.1E-184
score: 616.6
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 239..566
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 244..511
e-value: 1.2E-102
score: 342.9
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 10..566
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 10..566
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 31..62
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..30
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..11
NoneNo IPR availableTMHMMTMhelixcoord: 13..30
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 32..57
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..31
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..11
NoneNo IPR availableTMHMMTMhelixcoord: 10..31
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..36
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 37..49
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..11
NoneNo IPR availableTMHMMTMhelixcoord: 13..35
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 26..239

TPS4-like
Sequences
Sequence
ATGTCGTCTCAAATCTTAGCAACCTCATCCAAAAATGACAATATACATAA
AATTGTTCGGCCAACAACAAATTATCATCCTTCTATTTGGGGAGACCGAT
TTTTGCATTACGATATTCCAAAAGAAGAATTGGTGTATAAACAAGGCGAA
GTTGAAGAATTGAAAGAAGTGGTAAGAAAGGAGATATTTGGAGAATTCTT
ATGTGATGATTGGAGTAATCGATTGAAGTTAATTGATGTGGTGCAACGTT
TGGGATTGTCCTATCATTTTGAGAGTGAAATACAAAATGAGCTTCAACAC
ATTTACAACAAAATAAGCATTAATGATTCTAATTTCGAACATGAAACTTT
GCATGATGCTTCTATTCGGTTTAGACTTCTACGACAACATGGATATAGGG
TTTCTTTAGATATATTTGACAAGTTCAAAGATGAGAATGGCAACTTTAAA
GAATGTTTGGCGAGTGACACCGTTGGTTTGCTTAGCTTATATGAGGCCTC
ACATTTGAGCTGTGTTGGAGAAAATTTACTAGATGAAGCCCTTTCTTTCA
CTACCAAACACCTAACTGAATTTTTGGAAAATAATAAAAAAGAACACCCC
AATGATGATCCATTATCAAAGGAAATATCTCGAGCCCTAGAGAGGCCCTT
AAGAAAGACCCTAGTGAATCTCCATGCAAGGTATTTCATTTCAATATATG
AAAAAGATGCCTCACATAACAAAGTATTGCTACAACTTGCAAAGTTAGAT
TTCAATCTATTACAATCCATGCACAAAAAGGAGCTTAGTGAAATCTCAAG
GTGGTGGAAGGAATTAGACAGTGCACACAACTTTCCATTTGCAAGAAATA
GGATTGTGGAACTATATATTTGGATATTAGGAGTCTATTATGAACCCCAA
TACTCTTTTGCAAGAAATATTTTAGTGAAGATCATAGCACTTTCCTCAAT
CGCTGATGATATTTATGATTCATATGGTATATTTGAAGAACATAAGCTCC
TTATTGAAGCAATTGATAGGTGGGACAAAAATTGTATGGATAAACTCCAT
CCAGAATACTTGCAGAAATATTATAAGATACTTTTGCAATCTTTTGAGGA
ATTTGAACAAGAGTTTGAAAAGGAGGAAACTTACAAAGTTTACTATGGAA
AAGAAACGTTTAAAAGATTATTAAGAGGTTATTTTGAGGAAGCTCGATGG
TTGAATGAAGGATACATGCCAAGTTTGGAGGAGCATTTAAAAGTTTCTTT
GGTTACTTCTGGTTATTTCATGTTGATGGCTTGCTCTTTAGTTGGAATGA
AAAGTAACAATATTGTAACCAAACAAGTTTTCGAGTGGCTCTCCAAAGAC
CCCAAGATTGTTAGGGCAAGCGCTAGTGTTTGTAGGTACATGGATGACGT
GGCTGGTCACAAGAATGAGCAAGAGAGAAATCATATACCATCTACAATAG
AATGTTACATGAAGCAATATGGTGTATCAGAAGAAGAAGCATGTGATGAA
ATGAATAGGCGAGTGGTTATTGCATGGAAAGAAATAAACGAAGAGTTTCT
CAAACCAACTGAAGCAGCTTCACCTATATTAGTTCGTGCTCTGAATCTTG
CTAGGGTTATGGATCTTCTCTACAAAAATGGTGATAACTATACACAAGTT
GGAAAAGTCACTAAAGATAGTGTTGCTGTCTTGCTCATTGATCCAATTCC
A
Sequence Length
1701
Sequence Checksum
941c64de444594e0df911a39e01c5f5d
Summary
Resource Type
mRNA
Organism
Name
TPS4-like
Identifier
TPS4-like
Time Accessioned
Thursday, October 20, 2022 - 11:01
Time Last Modified
Thursday, October 20, 2022 - 11:01