TPS24

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR005630Terpene_synthase_metal-bd

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 52..52
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 24..51
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..23
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 26..52
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..25
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 49..94
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 29..48
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..28
NoneNo IPR availableGENE3D1.50.10.160coord: 55..257
e-value: 9.7E-143
score: 477.9
NoneNo IPR availablePANTHERPTHR31739FAMILY NOT NAMEDcoord: 39..783
NoneNo IPR availablePANTHERPTHR31739:SF3ENT-KAUR-16-ENE SYNTHASE, CHLOROPLASTICcoord: 39..783
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..31
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 32..55
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..11
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 459..726
e-value: 5.8E-70
score: 235.7
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 218..415
e-value: 1.0E-40
score: 139.5
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 48..466
e-value: 9.7E-143
score: 477.9
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 469..786
e-value: 2.8E-85
score: 288.1
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 457..782
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 226..439
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 58..240

TPS24
Sequences
Sequence
ATGTCTCATTCATTGCATTCCAACATTAGGTGCTCCTCCTCTTCTTCCTC
ATCAGCTTCTCCCATACCAAGACTAAATGGTGCAAGGAAAAGCAACATAG
CTGTTTTGAAGTTTGAGGAGACCAAAGAGAGAATAAAGAAGATGTTCAAT
AATGTTGAACTCTCTGTCTCGTCTTATGACACTGCCTGGGTGGCAATGAT
CCCTTCAAATTCTGGGCATCACCCTTTCTTTCCTCAATGTGTAAATTGGT
TACTAGAGAATCAGCACTCTGACGGTTCATGGGGTCTTCCTCATCGTCAT
CCCTTGCTTATGAAAGATGCTCTTTTATCTACTTTAACTAGTGTACTTGC
AATGAAGCGATGGGGTGTTGGCGAAGAACAAATAGACAAGGGCTTGTCTT
TCATAGAGGAAAATATAGCTTCAGCCATTGATGAGAAGCAATGTTCACCT
ATTGGATTTGAAGTAATATTTCCTACAATGATTGATTATGCGAAAAAATC
AGATCTGAATATTACTCTTGAGCCATCCAATTATAATGACCTAATTCATA
ACAGAAAGGTTTCACTTGAAAGAGCCTCAGGAAGCTACTCAGAGGGTCAT
GAAGCATACTTAGTGTACATTTCAGAAGGTCTTGGAAAGCCACTGGATTG
TGAAAGAGTCTTCAAGTACCAAAGGAAAAATGGTTCTCTGTTTAATTCTC
CATCCACCACAGCTGTTGCTTTTACAAACCATGGGAATGCTGACTGTCTT
AAGTATCTCTGCTCTGTTGTAGACAAGTTTGGAAGTGCAGTTCCAACAGT
ATATCCTCTAGATATTTATGCTCGTCTCTCAATGGTGGACAATCTCCAAA
GGTTGGGGATAGAACGATTTTTCAAAGAGGAAATCAGAAGTGTACTGGAT
GAAACATACAAATATTGGCTGCAAGGAGAGGAGTGTGTTCTCTTAGATGC
TTCCACCTGTGCAATGGCATTTCGTTTATTGCGTGTTAATGGATATGATG
TATCTTCAGATCCATTAATTCGATTTTCAGAAGATTATATATACAATTAC
CTTGGGAATCATACCAAGGATATAGATGCTATCTTGGAAATATTTAGAGC
ATCCGAGATCATCATACACCCAAATGAATCAATCTTGGAGAAGCAAAATT
TCTGTACAAGTCATTTTCTAGAACAAGAGTTATACAGCATTTCAACTAGG
GGAGATAAACTCAATAAAAATATTGGCAAAGTGGTAAGTGAAGCTCTTAA
GATTCCTTTCTATGCAAACTTGGAACGACTAGCAAGTAGAAGAGCCATAG
AGTACTATGACACTGATAGTACGAGGATTCTGAAAACTTCATATTGTTCC
TCAAATGTTCGGAGCAAGGATTTCCTAATATTAGCAGTTGAAGACTTCAA
CATGTGCCAATCAATACACCGTGAAGAACTCAAAATTCTTTCTAGGTGGG
TTGTAGAGAATAGGTTGGACAAGCTAAAGTTTGCTAGGCAGAAGCTGGCA
TACTGTTACTTTTCTGCTGCTGCTACTCTTTCTTCTCCTGAATTATCTGA
TGCCCGCATATCATGGGCGAAAAATGGGGTACTTACTACAGTGGTTGATG
ATTTTTTTGATATTGGAGGTTCAGAAGAGGAACTAGTAAACCTCATTCAA
TTGTTGGAAAAGTGGGATGTAGATGTCAGTGTTGATTGTTTGTCGGAGCA
AGTTGAAATTATTTATTTAGCACTTCATGGCACAATCTCTGAAATTGGAG
AAAAGGCGTTCGTGTGGCAAGGACGTAGTGTGACAAATCACATAATAGAG
ATTTGGCTGGATTTGCTCAAGTCTATGTTGAAGGAAGCTCAATGGTTGAA
ATACGAGACCGTCCCAACAATAGATGAGTATATGAAAAATGGATACATAT
CATTTGCCTTAGGACCTATAGTCCTTCCAGCACTTTACTTAGTTGGACCT
ATGCTTTCTGAGGATGTTACAAGACATCCTGAGCTCCATTATCTATATAA
ACTCATGAGCACTTCCGGACGACTTCTCAACGATATCCACGGCTTCAAGA
GAGAATCCAAAGAAGGGAAACTGAATATAGTGTCACTAAGCCTACTGGCG
CGTGGTTTTGGCTCTGGTTCTTCTTCTGAAGAAGAGATCATTAATGAAAT
GAAAAGTGCTGTAAATGGTAAGAGGAGAGAATTGCTGAGGCTAGTTTTTA
AGGAAAAAGATAGCATTGTTCCAAGAGCTTGCAAGGACTTGTTCTGGAAA
ATGAGCCAAGTGTTGCACCTATTTTATGCCAATGACGACGGATTCACCTC
AAATGAGATGATCAATGTCGCAAAAGCAATAATTGAGGAGCCCATAATTG
AAAATAAATTG
Sequence Length
2361
Sequence Checksum
6fc38b17cdc98e6188790ea40c73280f
Summary
Resource Type
mRNA
Organism
Name
TPS24
Identifier
TPS24
Time Accessioned
Friday, October 21, 2022 - 06:44
Time Last Modified
Friday, October 21, 2022 - 06:44