TPS30-like

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..19
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 20..36
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 37..42
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 7..29
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 30..46
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..6
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
NoneNo IPR availableCOILSCoilCoilcoord: 93..113
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 64..636
NoneNo IPR availablePANTHERPTHR31225:SF9coord: 64..636
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 30..50
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..29
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 51..59
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..15
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 35..42
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 16..34
NoneNo IPR availableTMHMMTMhelixcoord: 13..35
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 30..106
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..29
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..11
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 24..29
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 12..23
NoneNo IPR availableSIGNALP_EUKSignalP-noTMSignalP-noTMcoord: 1..29
score: 0.725
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 50..51
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..27
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 28..49
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 306..637
e-value: 7.2E-125
score: 418.0
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 291..635
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 75..235
e-value: 1.1E-46
score: 158.9
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 296..563
e-value: 4.8E-96
score: 321.2
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 75..305
e-value: 2.0E-71
score: 242.0
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 71..288

TPS30-like
Sequences
Sequence
ATGGCTGCATTAGTGTCCACTGTAAGTAGTATTATTAGGTGGAATAGTAA
TAATAATAATAATAATAACTTCACTAGATCTGTGAAATCATGTTTAAGTT
CAAATTACCATAATAATAATAATATTATTCATAATAAAACTGTATTAATG
TCCACCAATAATAATAATAATAATAATCAGAAGAATAGTTCTCGAAGATC
AGCAAACTATCAACCCCCACTTTGGCAATTTGATTATGTACAATCACTTT
CTTCTCCTTTCAAGGAAGGAGCATATGCCAAAAGAGTTGAGAAAGTAAAG
GAAGAGGTAAGAGTAATGGTGAAGAGAGCAAAAGAGGAGGAGAAGCCTTT
ATCTCAACTTGAGCTAATTGATGTAATGCAAAGACTTGGAATCTCTTACC
ACTTTGAGAATGAAATTAATGACATATTGAAAGATATATATAACAACAAT
AATGTGTGCAACACCAACAATAATGTGTATGCCAATTCTCTTGAATTTAG
ACTCCTAAGACAACATGGTTATCCGGTGTCTCAAGAAATATTTAGTACGT
GCAAAGATGAAAGAGGCAATTTTATGGTGTCTTCCAATGATATCAAAGGA
ATGTTATCTTTATATGAAGCTTCATTCTATTTGGTAGAAAATGAAGATGG
TATTTTGGAAGAGACAAGACACACAACAAAGAAATATCTTGAGGAATACA
TAATCATGATCATGGAAAAACAACAATCATTATTAGATCAAAATAATAAT
AATAATGATAATGATTATGATTATGAACTAGTGAGCCATGCATTGGAGCT
TCCACTTCATTGGAGAATGTTAAGATTGGAGAGTAGGTGGTTTATTGATG
TGTATGAGAAGAGACTAGACATGAACCCTACTCTACTTATGTTAGCTAAA
CTAGATTTCAACATTGTCCAATCAATATACCAAGATGATCTTAAACATGT
CTTCAGCTGGTGGGAAAGCACTGGTATGGGAAAGAAGTTGGAATTTGCAA
GAGATAGAACAATGGTGAATTTCTTATGGACAGTAGGAGTTGCATTTGAG
CCACATTTCAAAAGTTTTAGAAGAATGATTACAAAAGTAAATGCTTTAAT
TACAGTAATAGATGACATATATGATGTTTATGGTACACTAGATGAATTGG
AGCTCTTCACTAATGCAGTTGAGAGATGGGATATTAGTGCTATGGATGGG
CTCCCTGAGTATATGAAGACATGTTTCTTTGCTTTATACAATTTCATAAA
TGATCTTCCATTTGATGTGTTAAAAGGGGAAGAAGGCCTCCATATAATAA
AAGTCCTTCAGAAATCGTGGGCAGATCTTTGCAAATCTTATTTAAGAGAA
GCAAGATGGTATTATGATGGATACACACCAAGATTTGAAGAGTACATTGA
GAATGCATGGATATCAATATCAGGACATGTTATACTATCACATTTATACT
TTTTTGTAGTGAATCCAAACAAGGAAGATGCCTTATTAAGTACTTGCTTT
GATGGATACCCTACCATAATACGACATTCATCGATGATTTTACGTCTTAC
AGATGATCTTGCAACTTCAACGGATGAACTGAAAAGAGGCGATGTTTCTA
AATCAGTCCAATGCAAAATGCATGAAGATGGCGTGTCTGAAGAAGAAGCT
CGTCAACATATTAAGTTATTAATAAGTGAAACATGGAAACTTATTAATAA
AGATTACATAAATTTGGATGATGATCATGATGGTGATGACTACTCTCCAA
TGTTCTATAAGTCTAATAATACTAATAAGGCTTTCATTGAAATGTGTTTA
AACCTTGGTAGAATGGCACATTGCATTTATCAATATGGAGATGGACATGG
AATTCAAGATCGCCAAACAAAAGATCATGTACTATCATTACTTATTTACC
CTATTCCTCTTACCCAA
Sequence Length
1917
Sequence Checksum
afae7b0cf3933927b105498e457870b2
Summary
Resource Type
mRNA
Organism
Name
TPS30-like
Identifier
TPS30-like
Time Accessioned
Friday, October 21, 2022 - 20:13
Time Last Modified
Friday, October 21, 2022 - 20:13