TPS32

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..6
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..19
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 7..14
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 20..51
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 15..19
NoneNo IPR availableSIGNALP_EUKSignalP-noTMSignalP-noTMcoord: 1..24
score: 0.558
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 40..70
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..39
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 71..80
NoneNo IPR availableTMHMMTMhelixcoord: 40..62
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 30..42
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..29
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..11
NoneNo IPR availableTMHMMTMhelixcoord: 10..29
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 28..60
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..27
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..19
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 20..39
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 40..41
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 3..533
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 3..533
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 212..477
e-value: 4.9E-102
score: 340.8
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 14..517
e-value: 2.5E-185
score: 618.7
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 207..535
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 50..206
e-value: 2.5E-185
score: 618.7
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 14..181
e-value: 1.7E-47
score: 161.6
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 11..207

TPS32
Sequences
Sequence
AATGTTGTTGTTCGACCAACAACAAAATTTCACCCTTCTATTTGGGGAGA
TCGATTCCTCCATTACAATGTATCACAACAACACTTGGAATGCAAAGAAG
AACGAGTGAAGGAATTAGTTGAAGTTGTAAGGAAAGAGATAATGATATCA
TTATTATCATCATTGAAGTTAATTGATAGTGTTCAACGTTTGGGATTATC
ACACCATTTTGAGACTCAAATAGAACAAATGTTGGAAAAACATGATCTAA
ACTACTACAAACATGATCTACATCATGATTCTATTATGTTTAGACTATTA
AGACAACATGGGTTTAAGGTTTCATCAAGCATATTTGAGAAATTCAAAGA
CGAGAAAGGTAATTTTAAGAAAAGCTTGATAACCGATGTTTCGGGTTTGC
TTAGTTTGTATGAGGCTTCCTACTTGAGTTATGTTGGAGAAAGCATACTA
GATGAAGCACTTGCTTTCACAACCACTCACCTTAAGGCTATTGTGGCAAA
TAGTAAAGATCATCCATTATCACATCAAATATCCAAAGCATTGGAAAGGC
CATTAAGAAAGACCATAGAGAGGCTTCATGCTAGGTTTTATATCTCAATC
TATGAAAAGGATGCCTCTCATAACAAAGTATTGCTAGAACTTGCAAAGTT
AGATTTCAATCTACTTCAATGTTTCCACAAAATGGAGCTTAGTGAAATTA
TGAGGTGGTGGAAAAAGCATGACTTTGCAAACAAATTCCCTTTTGCAAGA
GATAGGATGGTGGAACTATATTTTTGGATGTTGGGTATATATTATGAACC
CAAATACTCTCGAGCAAGAAAGCTAACAACCAAAATCTCTGCTTTGATTT
CAATCACAGATGATATATATGATGCATATGGTACAATTGATGAGCTTGAG
CTTCTTACCCAAGCCATGCAAAGGTGGGACATAAATTTTATAGATAAACT
TGAGCCAGAATATTTGAAGACATATTATAAAGCAATGTTGACTTCTTATG
AAGAATTTGAAAAAGAGTTTACAAAGGAAGAATTATACAAACATCAATAT
GCAAAAGAAGAGATGAAAAAATTGATTCGAGCTTATTTAGAAGAAGCTCG
ATGGTTGAACGATGGATACTTGCCAAGCTTCGATGAGCATTTGAGAGTTT
CTTATGTTTCTTGTGCTTACACAACGTTAATCGCCACAAGTTATGTAGGA
ATGTATGATATTGTAACACATGAAACTCTAAATTGGCTCTCCAAAGACCC
TAAAATTGTTTCAGCTTCCACTCTACTTGCTAGGTTCATGGATGATATTG
GTTCTCGCAAGTTTGAGCAAGAGAGAAATCACATACCATCTACAGTGGAA
TGTTACATGAAGCAATATGGGGTATCAGAAAAAGAGGCAATTGAAGAACT
GAATAAAAGAGTGGTCAATTATTGGAAAGAAATTAATGAAGACTTCATTA
GGCCAACTGTTATGCCTTTCCCTATCTTAGTTCGTGTTCTTAATGTTACA
AAAGTATTGGATCTTCTTTACAAAAATGGTGATGATCAATATACACATGT
TGGAAAATTGTTTAAAGAAAGCATTGCTGCTTTACTTATAGATCCAATCC
CTGTA
Sequence Length
1605
Sequence Checksum
94183baef2a6f9c752df84d477d553ed
Summary
Resource Type
mRNA
Organism
Name
TPS32
Identifier
TPS32
Time Accessioned
Friday, October 21, 2022 - 20:13
Time Last Modified
Friday, October 21, 2022 - 20:13