TPS50

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR001906Terpene_synth_N

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 4..168
e-value: 2.7E-49
score: 167.5
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 209..530
e-value: 6.7E-107
score: 359.1
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 194..530
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 6..208
e-value: 6.6E-66
score: 223.5
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 199..477
e-value: 1.7E-93
score: 312.8
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 3..530
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 3..530
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 25..44
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..24
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 45..64
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 65..65
NoneNo IPR availableTMHMMTMhelixcoord: 36..58
NoneNo IPR availableTMHMMTMhelixcoord: 4..23
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 30..62
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..29
NoneNo IPR availableTMHMMTMhelixcoord: 2..24
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 11..192

TPS50
Sequences
Sequence
AATAACAAAGAGAGTTATGTGAAGATTATTGAGCTGAAGGAACAAGTGAA
GAAGAAATTACTTCATGGTCTTCATCCTTTGGAAAATCCTTTAGAGACAC
TTGAATATATTGATGATATTCAACGATTGGGGTTATCTTATTATTTTGAA
AATGAAATTGAACAAGTTTTGAAGCAATTTCATAATAATAATAACAATCT
TCATCATGATTTTGGTGATAATAACCTTTATGCTGATGCTCTTCGATTTC
GGTTGCTTAGGGAACAAGGTTATAATATTGCATGTGAGGTATTTGCCAAA
TATAAGAATGAGAAAGGAAAATTTAAGGAATCAATTTCGAGTGACATTCG
AGGAATGTTGAACTTGTATGAAGCTTCACAAATGAGAGTTCGCAGAGAAG
AAATACTAGATGAAGCTCTTATCTTCACAACTACTCATCTTCAATCCTTA
GTGGAAACATCCCAATTGAGCTCTCCTTATCTAGACCTAGTGAAACATGC
CCTAATGCACCCTATCCGAAAGAGCTTTCAAAGAAGAGAGGCAAGACTTT
ACATATCACTTTACCATCAACTACCTTCTCACGAAGAGCTTCTTTTAACC
CTCGCCAAACTAGATTTCAACTTGCTTCAACAACTACATCAAAAGGAATT
GAATTATATTACGAGGTGGTGGAAGGAGTTTGACTTCAAAAGTAAGCAAT
CTTTTTCAAGAGACAGAATAGTGGAGTGTTACATTTGGAATTATGGAGTA
TATTTTGAAGCTCAAACTTCCCAAATTAGGTTGATGATGACCAAGTTGAT
TTCTTTGCTTACTATTATTGATGATTCTTATGATAGCTATGGTACACTTG
AAGAGCTAAGGCCTTTTACTGAAGCATATATATATTTACTTAATAAATAT
GATATGATTATCAGGTGGGATATATCTGCTACTGACAACTTGCCAGAGTA
CATGAAAGTATGTTACAAAAAATGTTTAGAATTTTTCAATGAAATTGAAG
AATTTACAAAGGAAAATTCATACTGCGCGAGTTATATTAAGAAAGGGTTG
CAATGTATGGTTAGAGCTTATAGTAAGGAAGTCCAATGGTTACACAATAA
ATATATGCCAACATTTGATGAATATTATCCAATTGGACTTGATAATGCTG
GATCTGAAGAGCTAATATCAATGGCCTTTTGTGGAATGGGAGATGTTGTA
ACAAAAGAATCTATGGATTGGATATTTTCTCAACCCCAACCTAAGATTAT
ACGAACTATGTCAATTGTTGGAAGACTTATGAATGACATTGGCTACCACA
AGTCGGATCGAAGAAAATTATCAAAAGATGTAGTGGCTTCTGCTGTGGAG
TGTTACATCAAACAATATGGTGTAACAGATGAAGAAGCTATAGAGAAACT
TAACGAACAAGTTAATGATTCATGGAAGGATCTCAATGAAGATCTTCTCT
ATCCAATCGCTATTCCTAGACCACTCTTAATGAGAGTTCTCAATCTTGTA
CGAGTGAACCATGAGATGTACAGAGAAGGTGACGGTTTTACACAACCAAC
ATTGCTCAAGAATTTGATTGATACTCTCATCATCAATCCC
Sequence Length
1590
Sequence Checksum
ecb8fcc735caa3983ea736d9dbf9e7a4
Summary
Resource Type
mRNA
Organism
Name
TPS50
Identifier
TPS50
Time Accessioned
Thursday, October 20, 2022 - 19:10
Time Last Modified
Thursday, October 20, 2022 - 19:10