TPS48

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR005630Terpene_synthase_metal-bd

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableCOILSCoilCoilcoord: 13..33
NoneNo IPR availableCOILSCoilCoilcoord: 362..382
NoneNo IPR availablePANTHERPTHR31739FAMILY NOT NAMEDcoord: 1..440
NoneNo IPR availablePANTHERPTHR31739:SF25(E,E)-GERANYLLINALOOL SYNTHASEcoord: 1..440
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 13..23
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 24..28
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..12
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 29..36
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..28
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 117..382
e-value: 9.1E-62
score: 208.8
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 16..73
e-value: 2.2E-10
score: 40.5
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 127..440
e-value: 1.5E-75
score: 256.1
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 112..436
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 1..125
e-value: 3.4E-31
score: 110.2
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 16..92

TPS48
Sequences
Sequence
TGGTTCCTAAAGAATGAGGAAATAAAAAACTACATAGAATTCAACTCTGA
ATACTTTTTTGTTGCAATGCTAAATCTTTACAGAGCTACTGATCTTGCTT
TTCATGGTGAATTTGAGCTTGATGAACTAAGAACATTTTCAAGAAAATTA
CTTGAGAAATCTATTTCAGAAGGAGCTCAACATACAAATCCCTTTAAGAA
ACTGATTGAGCATGAGTTAAGTCTTCCATGGATGGCTCGACTAGATCACC
TCGAACATAGGTTTTTTATCGAACAAACTAATAAAGCTTTATGGATGGGA
AAGACATCTTCACAAAGGTTATCAAAGTTTTACAATGATAAATTAATTCG
TCTAGCCACTTTAAACTACGAGTTCAAACAGTATATTTACAAGACTGAAC
TTGAACAGTTAACAAGGTGGTCTAAAGAATGGGGACTTAGTGAAATGGGA
TTTGGTAGAGAAAAAAGTACATACAATTATTTTGCAGTAGCTTGTGCTTG
CTGTTATTTGCCTTATGATTCTCCAATTCGATTGATGATTACAAAGGGTG
CTATAATAGTAACGGTTGCTGATGATTTTTTTGATATGAAAGGCTCTCTA
TTCACTGATTTAAAATTCTTCACTAAGGCAATTCAAAGGTGGAATAATGA
AGGGTTGAGTGGTGTTAGTAAAAAGATATTTGATGCCCTAGATAATCTTG
TAAGGGAAATGTCAACTATGTACCTTGAACAACAAGAAAAAAGTCATGAA
GACATAACCAGCTACATAAGAAAAATTTGGTATGAAACGATTTGTTCATG
GCTTACTGAATCTGAGTGGAGTAAAAGTGGAATTGTACCAACCATGGAAG
AATATTTTAAAGTTTCAATGACTTCTGTAGCAACTCATACCTTGCTTCTT
CCAGCTTCATTTCTTCTGAAACCGACCTTAAAAAAATCTCAGTTACAATT
AATGGAGTATAAAAGTGTTACTAAATTGGTCATGATTATTTGTCGTTTGT
TGAATGACTTACAAAGTTCTGAGAGGGAAAGAGAAGAAGGCAAACCAAAC
TCAATCACAGTTTACATGAAGAATAATTTTGAGATAGAGAATAAGGAAGA
AGTAGTAAAGTACTTGAAAGAGATATTAAACGATAAGAAGAAGGAGTTCC
TTGAGCATGTTTTGATTAATGACAATGGTTTTACCAATCTTCCTAAAGAG
TGTAGGCTTCTACACTTATCTTGCTTAAAAGTATTCCAAATGTTCTTTAA
CTCTTCAAATCGATATGATTCAGACACTGAATTGCTTGAAGACATTAACA
AAGCGATTTACATTCCTTTG
Sequence Length
1320
Sequence Checksum
0869940c18e70e9fff82ce0214206833
Summary
Resource Type
mRNA
Organism
Name
TPS48
Identifier
TPS48
Time Accessioned
Wednesday, October 19, 2022 - 16:32
Time Last Modified
Wednesday, October 19, 2022 - 16:32