TPS23

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 240..506
e-value: 1.7E-98
score: 329.3
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 29..545
e-value: 9.8E-183
score: 610.1
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 235..561
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 29..209
e-value: 6.3E-53
score: 179.3
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 68..234
e-value: 9.8E-183
score: 610.1
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 10..561
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 10..561
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 22..32
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..21
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 52..57
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 33..51
NoneNo IPR availableTMHMMTMhelixcoord: 2..21
NoneNo IPR availableTMHMMTMhelixcoord: 31..53
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 12..16
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 17..59
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..3
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..16
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 4..11
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..20
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 16..20
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 21..75
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..7
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 8..15
NoneNo IPR availableSIGNALP_EUKSignalP-noTMSignalP-noTMcoord: 1..20
score: 0.744
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..20
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 21..45
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 46..48
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 26..235

TPS23
Sequences
Sequence
ATGTTCACACAAATCTTAGTATCATTATCTTCAAATGACAACCCAAATAT
AATTGTTCGTCCTACAAAAAAATTCCACCCAAATATTTGGGGAGAACGAT
TCTTACATTACAACATTTCACAACAAGATTTGTATTGTCAACAACAAAAG
GTTGAGGAATTAAAAGAAGTGGTTAGAAGAGAAATATTTGGAGATTATTA
TTATGATGCTTGGAAAAATCAATTGAAGATAATTGATGTGGTAGAACGTT
TGGGATTGTCTTATCATTTTGAAACTGAAATAGAAAATAAGCTTCAATGC
ATTTACAACAAAACCAATATTGATGATGAAGATTTACACCATGTTTCTAT
TCGATTTAGACTTCTACGGCAACATGGATTTAGAATTTCTTCTGCAGATA
TATTTGAAAAATTCAAAGATGAGGATGGGAACTTTAAAAAATGCTTGGTA
AGTGATACCCTTGGTTTGCTTAGCTTATATGAAGCCTCACATTTGAGCTG
TGTTGGAGAAAATATACTTGATGAAGCACTTGCTTTCACAACAACACACC
TAAATGAGTTTTTGGCGAAGAAAAAAGAACACCATGAAGACGATGATCCA
TTATCGAAAGAAATATCTCGAGCCCTAGAGAGGCCCTTAAGAAAGACCCT
AGTAAATCTTCATGCAAGGCATTTCATTTCGATATATGAAAAAGATGCCT
CACATAACAAAGTATTGTTACAACTTGCAAAATTAGATTTTAATCTATTA
CAATGCATGCACAAAAAGGAGCTTAGTGAAGTCAGCAGGTGGTGGAAAGA
ATCAGATTTTGTACACAAATTTCCATTTGCAAGAGATAGGATTGTGGAAT
TGTACCTTTGGATATTAGGAGTTTATTATGAACCCCAATACTGTTTGGCA
AGAAATATTCTAGTCAAAATCATAGCTTTGGCCTCAATTGCTGATGATAT
TTATGATGCATATGGTACACTTGAAGAACTTGAGTTCCTAACTCATGCAA
TTGAAAGGTGGGATATAAATTGTGTAGATAAACTGAATCAGGAATATATG
CAAACATTTTATAAAGATGTTTTGAATTGTTATGAAGAGTTTGAGCAACT
GCTAGAAAAAGAAGAAACATACAGAGTTCATTATGCAAAAGAAGCGTTTA
AGGGATTAGTTCAATCTCATTTGAATGAAGCTCGATGTTTGCATAGAGGA
TACATCCCAAGTTTTGAAGAGTACTTGAAATTTGCTTTGGGTAATTGTGG
TTACTACATGTTGATACTAAGCTCTTTGGTTGGAATGAAAACTAATATTG
TAACAAAAGAAGTTTTTGAGTGGCTCTCGAAAGATCGAAAGATTATTAGA
GCATCTGTTACTATTTGTAGGCTAATGGATGACATAGCCGAACACAAGTT
TGAGGAAGATGATTATGAGGAACATTCAGCAGTGGAATGCTATATGATTG
AACATGGCGTTTGTGAAGAGGAAGCCTATGATGAACTGAATAAGCTAATA
ATGAATGCATGGAAAGAAATAAATGAAGAGTTTTTGAAGCCTACTAAAGT
AGCTTCACCTATATTACTTCGTGCTCTTAACTTTTCAAGGGTTATGGATC
TTATTTTCAAATTTGGAGATGGTTATACACACGTTGGAAAAATCACCAAA
GATATTGTTGCTGCTTTGCTTATTCATCCAATT
Sequence Length
1683
Sequence Checksum
2cd67d7f69e86cfda8e189daf411dd26
Summary
Resource Type
mRNA
Organism
Name
TPS23
Identifier
TPS23
Time Accessioned
Friday, October 21, 2022 - 20:11
Time Last Modified
Friday, October 21, 2022 - 20:11