TPS13-like2

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 30..50
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..29
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 51..59
NoneNo IPR availableCOILSCoilCoilcoord: 89..109
NoneNo IPR availablePANTHERPTHR31225:SF9coord: 60..632
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 60..632
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 34..46
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..11
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..33
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
NoneNo IPR availableSIGNALP_EUKSignalP-noTMSignalP-noTMcoord: 1..19
score: 0.482
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 30..106
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..29
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..11
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 24..29
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 12..23
NoneNo IPR availableSIGNALP_EUKSignalP-noTMSignalP-noTMcoord: 1..29
score: 0.725
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..15
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 34..41
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 16..33
NoneNo IPR availableTMHMMTMhelixcoord: 13..33
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 28..39
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..27
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 50..51
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..27
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 28..49
NoneNo IPR availableTMHMMTMhelixcoord: 28..50
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 293..560
e-value: 4.4E-96
score: 321.3
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 71..302
e-value: 8.0E-71
score: 240.0
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 76..231
e-value: 1.5E-46
score: 158.5
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 303..633
e-value: 1.1E-126
score: 423.9
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 288..631
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 67..285

TPS13-like2
Sequences
Sequence
TCTATAATGGCTGCAATATTAAGTAGTATTATTAGCTTGAATAGTAATAA
TAATAATAATACCTTCACTAGATGTGTGAAATCATGTTTAAGTTCAAACC
ATAATAATTATAATATTATTCATAATAAAACTGTAATAATGTCCACCAAT
AATAATAATAATATTAATAATATTATTTCTCGAAGATCAGCAAACTATCA
ACCTTCACTTTGGCATTTTGATTATGTACAATCACTTTCTACCCCTTTCA
AGGAAGGAGCATATGCCAAAAGAGTTGAGAAAGTAAAAGAAGAGGTAAGA
GTAATGGTGAAGAGAGCAAAAGAGGAGGAGAAGCCTTTATCTCAACTTGA
GCTAATTGATGTAATGCAAAGACTTGGAATCTCTTACCACTTTGAGAATG
AAATTAATGACATATTGAAAGATATATATAACAACAATAATGTGTGCAAC
ACCAACAAAAATGTCTATGCCAATTCTCTTGAATTTAGACTCCTAAGACA
ACATGGTTATCCAGTGTCTCAAGAAATTTTTAGTACGTGCAAAGATGAAA
GAGGCAATTTTATGGTGTCTTCCAATGATATCAAAGGAATGTTATCTTTA
TATGAAGCTTCATTCTATTTGGTAGAAAATGAAGATGGCATTTTGGAAGA
GACAAGACACACAACAAAGAAATATCTTGAGGAATACATAATCATGATCA
TGGAAAAACAACAATCATTATTAGATCAAAATAATAATAATTATGATTAT
GATAATTTTGATTATGAACTAGTGAGCCATGCATTGGAGCTTCCACTTCA
TTGGAGAATGTTAAGATTGGAGAGTAGGTGGTTTATTGATGTGTATGAGA
AGAGACTAGACATGAACCCTACTCTACTTACCTTAGCTAAACTAGATTTC
AACATTGTCCAATCAATATACCAAGATGATCTTAAACATGTCTTCAGCTG
GTGGGAAAGCACTGATATGGGAAAGAAGTTGGAATTTGCAAGAGATAGAA
CAATGGTGAATTTCTTATGGACTGTAGGAGTTGCATTTGAGCCACATTTC
AAAAGTTTTAGAAGAATGATTACAAAAGTAAATGCTTTAATTACAGTAAT
AGATGACATATATGATGTTTATGGTACACTAGATGAATTGGAGCTCTTCA
CTAATGCAGTTGAGAGATGGGATATTAGTGCTATGGATGGGCTCCCTGAG
TATATGAAGACATGTTTTCTTGCTTTATACAATTTCATAAATGATCTTCC
ATTTGATGTGTTAAAAGGAGAAGAAGGCCTCCATATAATAAAATTCCTTC
AGAAATCGTGGGCAGATCTTTGCAAATCTTATTTAAGAGAAGCAAGATGG
TATTATAATGGATACACACCAAGCTTTGAAGAGTACATTGAGAATGCATG
GATATCAATATCAGGACCTGTTATACTATCACATTTATACTTTTTTGTAG
TGAATCCAATCAAGGAAGATACCTTATTAAGTACTTGCTTTGATGGATAC
CCTACCATAATACGACATTCATCGATGATTTTACGACTTACAGATGATCT
GGGAACTTCAACGGATGAATTGAAAAGAGGCGATGTTCCCAAATCAATCC
AATGCAAAATGTATGAAGACGGTATATCTGAAGAGGAAGCTCGTCAACGT
ATTAAGTTATTAATAAGTGAAACATGGAAGCTTATTAATAAAGATTACAT
AAATTTGGATGATGATGATGGTGATGACTACTCTCCAATGTTCTATAAGT
CTAATAATATTAATAAGGCTTTCATTGAAATGTGTTTAAACCTTGGTAGA
ATGGCACATTGCATTTATCAATATGGAGATGGACATGGAATTCAAGATCG
CCATACAAAAGATCATGTACTATCATTACTTATTCACCCTATTCCTCTTA
CCCAA
Sequence Length
1905
Sequence Checksum
7c6280d777b966a046ea2f2ef5e2a036
Summary
Resource Type
mRNA
Organism
Name
TPS13-like2
Identifier
TPS13-like2
Time Accessioned
Friday, October 21, 2022 - 20:11
Time Last Modified
Friday, October 21, 2022 - 20:11