TPS62

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR036965Terpene_synth_N_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 12..183
e-value: 1.9E-168
score: 563.0
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 184..489
e-value: 1.9E-168
score: 563.0
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 189..496
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 190..454
e-value: 1.3E-86
score: 290.3
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 13..143
e-value: 7.8E-41
score: 139.9
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 14..505
NoneNo IPR availablePANTHERPTHR31225:SF99coord: 14..505
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 34..53
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..33
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 54..72
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 26..68
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..25
NoneNo IPR availableSIGNALP_EUKSignalP-noTMSignalP-noTMcoord: 1..26
score: 0.646
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 24..50
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..23
NoneNo IPR availableSIGNALP_EUKSignalP-noTMSignalP-noTMcoord: 1..11
score: 0.485
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 20..44
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..19
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 45..61
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 15..181

TPS62
Sequences
Sequence
GATTTAGATAAATACAGGGACGTTTTAAGAAAAGCAGACCCATTTGATGA
AGGTCTGAAGATGATTGATGCTATTCAACGGCTAGGAATTGACTATATCT
TCGAGGAAGAGATTGATAAAATTATACAAAGCCAGTCTGCTTATAAGTTT
TTTAGAGAATTCGAGCATGATCATCATCATCATCAAGATCTGTATGATGT
AGCTCTTCGTTTTCGACTCTTGAGACAACACGGTCACTTCGTTCCTGCTG
ATATTTTCAACAAGTACAAGGACAATAATAAGGGTTGTTTCGACACAAGG
CTAAGAGAGGACATCAAGGGTTTGCTGAGCTTATATGAAGCCTCCCATCT
ATGCATAGAGGGAGAAAATATCCTTGATGAAGCTGCTTTATTTAGTGCTC
AACACTTGGAAGCGTCCATGACACGTCTTCATCGTTATGATCAATATCAG
GCCAAATATGTGGCAACTACACTTCAAAATCCCACTCACAAAAGTTTATC
CAAGTTCACAGCCAAGGACCTTTTTGGTGTCTATCCCAGTCAGAATGGGT
ACATAAATTTGTTTCAACAACTAGCAAAAGTTGAATTTAATAGAGTTCAG
TCCCTGCATAGAATGGAAATTGATAAAGTCACCAGATGGTGGCGAGACAT
TGGTTTAGCTAAGGAATTAACTTTCGCAAGAGATCAACCGGTGAAGTGGT
ATATTTGGTCCATGGCCTGCCTAACCGATCCAATCTTGTCGAAACAAAGG
GTTGCGCTTACAAAATCCATTTCGTTTATCTATGTAATAGATGATATTTT
CGACATGTACAGTTCACTTGATGAACTCATTCTCTTCACCCAGGCTGTCT
CTAGCTGGGAATATAGTGCTATAGAAAAACTTCCAGACTCCATGAAGACA
TGCTTTAAAGCCCTAGATAATATGATCAATGAGTCTAGCCATACGATCTA
TCAAAAGCGTGGATGGAGCCCTTTACACTCTCTTCGGAAGACGTGGGCAA
GTTTGTGCGAAGCCTTTTTAGTAGAGGCAAAATGGTTTGCATCAAGGCAC
GTACCAAAGGCAAAAGAATACTTGGAAAATGGTGTGGTCAGCTCAGGAGT
GCACGTAGTTCTGGTTCATATATTTGTTCTCTTGGATGAAACCAGTCTCA
CCCAAAAGACACTGGATTTTGTGGAAAACATGCCTTCCATCATTACTTCT
ACAGCATCGATTCTTAGGCTTTGGGATGACTTTGGTAGTGCCAAGGATGA
GAATCAAGAAGGACATGACGGATCTTATGTGGAGTGTTACATGAAGGAAT
TAGGAGGCAGTGTTGAAGATGCACGTGAGGAAATGATGGAAAAGATTTCA
GATGCATGGAAGTGCCTCAACAAAGAATGCATACTTCGAAATCCAGCGTT
TCCACCACCATTCCTCAAAGCTTCTCTCAATCTCGCAAGATTAGTTCCTT
TGATGTATAATTATGATCACAACCAACGCCTACCCCACTTGGAAGAACAT
ATCAAATCTTTGTTA
Sequence Length
1515
Sequence Checksum
ba5d1d99e84348dc7b3f260e59b1224d
Summary
Resource Type
mRNA
Organism
Name
TPS62
Identifier
TPS62
Time Accessioned
Friday, October 21, 2022 - 20:11
Time Last Modified
Friday, October 21, 2022 - 20:11