TPS46

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 28..51
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 52..67
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..27
NoneNo IPR availableTMHMMTMhelixcoord: 28..50
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 32..43
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..31
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..11
NoneNo IPR availablePANTHERPTHR31739:SF25(E,E)-GERANYLLINALOOL SYNTHASEcoord: 1..436
NoneNo IPR availablePANTHERPTHR31739FAMILY NOT NAMEDcoord: 1..436
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 128..441
e-value: 1.5E-77
score: 262.6
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 112..417
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 14..73
e-value: 1.1E-7
score: 31.8
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 1..124
e-value: 2.3E-29
score: 104.4
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 118..380
e-value: 8.8E-65
score: 218.7
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 15..92

TPS46
Sequences
Sequence
TGGTTCTTACATAACGAAGAAATTAAAAATCACATCGAGACAAACTGCGA
ATACTTTTCGATTATGTTGTTAAATCTTTACAAAGCCACAGATCTTGCTT
TTCAAGATGAATTTGAGCTTAATGAAGCAAGAAATTTTTCAAGAAAACTA
CTTGAGAAATGTATTTCAATGGAAGAAAATGGAGATCACATATTTCATAA
TCTGATTGAGCATGAATTAAGTCTTCCATGGATGGCCCGATTGGACCACC
TCGAACATAGGTTTTGGATAGAAGAAACTAAAAACCATGTTCTATGGCTT
GGAAAGAATCATTTTCGAAGGTTGTTAAGCATTCATAATGACAAATTAAT
TCGTCTAGCCATCTTAAATTACCACTTCAAACAATCTATCTTCAAGGCTG
AACTCGAACACTTAACAAGGTGGTGTAAAGATTGGGGACTTAGTGAAATG
GGATTTGGTAGAGAAAAAAGTATGTATTGTTATTTCGCAATAGCTTCAAC
TTGTAGTTCTTTGCCTTATGATTCTCCAATTCGATTGGCGGTTGCAAAAG
GTGCTATAATAATAACGGTGACAGATGATTTTTTTGATATGAAAGACTCC
TTAATCACCGAGTTAGAAAACTTTACTAAGGCAATTCAAAGGTGGGATGG
TGAAGGATTGAGTGGTGTTAGTAAGAAAATATTTGATGCCCTAGATAATT
TTGTAAAGGAAATGGCAATTATGTACCTTGATCAACAAGAAACAAGTGAC
ATCACAAATTTCTTAAGAGAAATATGGTATGAAACAATTGTTTCATGGCT
TACTGAATCTAAATGGAGTAAAAGTGGGATTATACCAACCATGGATGAAT
ATTTTAAAGTTGGAATGACTTCTATAGCAACTCACACCTTGCTTCTTCCA
GCTTCATATTTTCTAAAGCCAAGCTTAAAAATATCCCAATTACAATCAAC
GGAGTATGCCATCGTTACTAAATTGGTTATGATTATTTGTCGTTTGTTGA
ATGACATACAAAGTTATGAGAAAGAAAAAAATGAGGGCAAACCAAACTCA
ATTACAGTGTACTTGAAGAACAATCCCGAGGTAGAGATCGAAGAAGCAAT
CGAGTACGTGCAAGAGATACTAAATAAAAAGAAGAAAGAATTACTTGAGC
ATGTTTTGATTGACAACGACGACGATGATGATGTTAGGGTTTTGCACCTC
TCTTGCTTAAAAGTATTTCAAATGTTCTTCAACTCTTCGAATCGATTTGA
TTCAGAGGTTGAATTGCTTGATGATATTGGCAAAGCGATCTATATTCCTT
TGAAGTTAGATGGATTAGCATCTAATAAA
Sequence Length
1329
Sequence Checksum
2285c3d89d2954b615d94d59f1ad8ea6
Summary
Resource Type
mRNA
Organism
Name
TPS46
Identifier
TPS46
Time Accessioned
Thursday, October 20, 2022 - 22:41
Time Last Modified
Thursday, October 20, 2022 - 22:41