TPS47

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR001906Terpene_synth_N

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 210..420
e-value: 4.6E-35
score: 121.1
NoneNo IPR availableGENE3D1.50.10.160coord: 33..244
e-value: 2.6E-141
score: 473.2
NoneNo IPR availablePANTHERPTHR31739:SF29coord: 11..765
NoneNo IPR availablePANTHERPTHR31739FAMILY NOT NAMEDcoord: 11..765
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 21..43
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..20
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 44..69
NoneNo IPR availableTMHMMTMhelixcoord: 21..43
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..19
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 38..39
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 20..37
NoneNo IPR availableTMHMMTMhelixcoord: 20..37
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 21..473
e-value: 2.6E-141
score: 473.2
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 477..770
e-value: 6.9E-67
score: 227.6
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 461..761
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 575..707
e-value: 6.6E-28
score: 97.8
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 36..146
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 214..439

TPS47
Sequences
Sequence
GAATTCCAATCTTTGCCCCAAACTCAGGCTAAGTTGATCAACGAGATCAA
AGAAACGATGTTCTCATCGTTAGACATCAATCCTTACTCCCTCGTTTCTC
CTTGTGCTTACGACACTGCATGGCTAGCCATGATACCACATCCTAACCAA
CCTTCGAAGCCTATGTTCGAGGGTTGTTTGAGTTGGGTGCTTAACAACCA
AACCGAACATGGCTTCTGGGGTAACTGTGATGACCAGAGTGGCATGCCAA
CCCTAGAGTGTCTGACTGCCACTCTGGCTTGTGTTGTTGCCCTAAGAAAG
TGGAATGTTGGTTCTTCCATGATAAGTAAAGGGTTGGAATTTATTCATTC
ATCTAATGCAAAAAGGCTCTTAAAAGAAATGAAAAAAGAAGGCTTTATTC
CTCAATGGTTTGCAATCGTTTTCCCGGGAATGGTTGAATTGGCTGAAGAA
GTTCTCAAAATCCAAATCTTAAAGGATCAATCCGTTTTCGTTTCGGACAT
ATTTTACCATAGGCAACTCATTTTCAAAAAGTACATATATTTAGAGCTAC
ATAATAAGGAGACATATTTGTTATCATATCTTGAAGTGTTGCCATCATCA
TATTTTAATGAAGAATTAATAATAAAAAAATTGTGTGAAAAGGGTTCTTT
GTTCCAATCTCCATCGGCAACAGCACAAGCTTTCATGGCAACTGAAAATT
CCAAATGCTTGCATTATTTGCAAACCCTAGTTCACAAGTTTTCCAATAAT
AACAACAATAATATCATTGGAGTTCCCACTACATATCCCATGGACAAAGA
TCTTATAAAGCTTTGCATTATCAACTATGTCGAAAGATTAGGGTTAGCTG
AGCATTTCGCTATCGAAATCGAACAACTTCTACAACAAGTTTATAAGAAT
TATGTGAAATGCGATGGAGAATTTTATTACGAAAAAAGTTACTATTCATT
GGCAACTTTAGAGTTACACCTACTCAAAGAATCATTAGCTTTTAGGCTTC
TAAGGATGCATGGCTACAAAGTTTTTCCTAGTAACATCTATTGGATTTTG
AAGAATGAGGATATAAAAAATCACATAGAATCAAACTATGAATGCTTTTC
GGTTACGATGTTGAATCTTTACAGAGCTACTGATCTTGCTTTTCATGGTG
AATTTGAGCTTGATGAACTAAGAATATTTTCGAGAAAACTACTTCAAAAG
TCTATTTTAGTAGGAGCTCCACATACAAATCCTTTTAACAAACTGATTGA
GAATGAGTTAAGTCTTCCATGGATGGCTCGACTAGATCACTTGGAACATA
GACTTTTTATTGAACAAACTAATGAAGCTCAATCATCTTTATGGATGGGA
AAGACTTCTTTCCAAAGGTTGTCGAGGTTTCACAACGACAAACTAGTTCG
TCTAGCCACCTTAAATTATGAGTTCAAACAATCTATTTACAAGACCGAAC
TTGAACAATTAACAAGGTGGTGTAAATATTGGGGACTTAATGAAATGGGA
TTTGGTAGAGAAAAAAGTACATACTGTTATTTTGCAGTAGCTTCAGCTTG
TTGTTCTTTGCCTTATGATTCTCCAATTCGATTGATGGTTGCAAAGGGTG
CTATAATAATAACAATTACAGATGATTTTTTTGATATGAAAGAATCTCTA
ATCACTGAGTTAAAAACTTTTACTAAGGCCTTTCAAAGGTGGGATGGTAA
AGAATTGAGTGGTGTTAGTAAGAAAATATTTGATGCCCTAGATAATCTTT
GGTATGAAACGATTTGTTCATGGCTTACTGAATCGGAGTGGAGTAAAAAT
GGGATTGTACCAACCATGGATGAATATCTTAAAGTTGGAATGACTTCCAT
AGCAACTCACACCTTGCTTCTTCCAGCTTCTTGTTTTGTAATAAATCCAA
CTTTACCGGTCTACTCTCAATTACGACCAATTCAATGTGAGAGTGTTACA
AAACTCGTCATGACTATTTGTCGTCTGTTAAATGACTTACAAAGTTATGA
GAAGGAAAAAGAAGAAGGCAAACCAAACTCAATTACTGTGTACATGAAGA
ACAATTCTGAGGTAGAAATGGAAGAAGCAGTAAAGTACGTGAAAGAGATA
TTAAACAAGAAGAAGAAAGAGTTACTCGAACATGTTATGATTGATGGCTT
TACCAATCTTTCAAAAGAGTGTAGGCTTCTACACCTCTCTTGCTTAAAAG
TATTTCAAATGTTCTTCAACTCTTCGAATCGATATGATTCAGACACTGAA
ATGCTTGACGACATTAGCAAAGCAATCTATGTTCCTTTGAAATCAATTGA
TCATGAAGGACTCGAAAAGAATCTCTTAAGGCCTCCAAAGTCACCGATGA
TTGATCTTACTCGAGTCAAATCAACGACCATGAAATGTTCGATGAACATG
AATAAATTTAGTCAACCCTCTAAATGTCTAACCGCTAAATATTTTGTCAT
GAATGAGCTTTCTCTTCATAAACACAACAAGGTTGAGAACTTGAAAATAA
CTACACCTACTATGCCTTCAAAACTCAATTTTTTCTTTATT
Sequence Length
2541
Sequence Checksum
aa95707bc1c48d43f9b9127785232909
Summary
Resource Type
mRNA
Organism
Name
TPS47
Identifier
TPS47
Time Accessioned
Friday, October 21, 2022 - 20:10
Time Last Modified
Friday, October 21, 2022 - 20:10