TPS9-like2

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR001906Terpene_synth_N

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..36
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 37..49
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..11
NoneNo IPR availableTMHMMTMhelixcoord: 12..34
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..24
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 31..51
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 25..30
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 52..65
NoneNo IPR availableTMHMMTMhelixcoord: 5..24
NoneNo IPR availableTMHMMTMhelixcoord: 31..53
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 10..566
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 10..566
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 62..78
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..39
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 40..61
NoneNo IPR availableTMHMMTMhelixcoord: 40..62
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 30..56
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..29
NoneNo IPR availableTMHMMTMhelixcoord: 10..29
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 24..47
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 8..18
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..7
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..23
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 19..23
NoneNo IPR availableSIGNALP_EUKSignalP-noTMSignalP-noTMcoord: 1..23
score: 0.481
NoneNo IPR availableTMHMMTMhelixcoord: 15..37
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 29..213
e-value: 7.2E-54
score: 182.4
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 244..511
e-value: 1.2E-102
score: 342.9
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 68..238
e-value: 9.9E-185
score: 616.7
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 29..550
e-value: 9.9E-185
score: 616.7
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 239..566
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 26..239

TPS9-like2
Sequences
Sequence
ATGTCGTCTCAAATCTTAGCAACCTCATCCAAAAATGACAATATACATAA
AATTGTTCGGCCAACAACAAATTATCATCCTTCTATTTGGGGAGACCGAT
TTTTGCATTACGATATTCCAAAAGAAGAATTGAATTATAAACAAGGCCAA
GTTGAAGAATTGAAAGAAGTGGTAAGAAAGGAGATATTTGGAGAATTATT
ATGTGATGATTGGAATAATCGATTGAAGTTAATTGATGTGGTAGAACGTT
TGGGATTGTCCTATCATTTTGAGAGTGAAATACAAAATGAGCTTCAACAC
ATTTACAACAAAATAAGCATTAATGATACTAATTTCAAACATGAAACTTT
GCATGATGCTTCTATTCGGTTTAGACTTCTACGACAACATGGATATAGGG
TTTCTTTAGATATATTTGACAAGTTCAAAGATGAGAATGGAAACTTTAAA
GAATGTTTGGCGAGTGACACCGTTGGTTTGCTTAGCTTATATGAGGCCTC
ACATTTGAGCTGTGTTGGAGAAAATTTACTAGATGAAGCCCTTTCTTTCA
CTACCAAACACCTAACTGAATTTTTGGAAAATAATAAAAAAGAACACCCC
AATGATGATCCTTTATCAAAGGAAATATCTCGAGCCCTAGAGAGGCCCTT
AAGAAAGACCCTAGTGAATCTCCATGCAAGGTATTTCATTTCAATATATG
AAAAAGATGCCTCACATAACAAAGTATTGCTACAACTTGCAAAGTTAGAT
TTCAATCTATTACAATCCATGCACAAAAAGGAGCTTAGTGAAATCTCCAG
GTGGTGGAAGGAATTAGACAGTGCACACAACTTTCCATTTGCAAGAAATA
GGATTGTGGAACTATACATTTGGATATTAGGAGTCTATTATGAACCCCAA
TACTCTTTTGCAAGAAATATTTTAGTGAAGATCATAGCACTTTCCTCAAT
CGCTGATGATATTTATGATTCATATGGTATATTTGAAGAACATAAGCTCC
TTATTGAAGCAATTGATAGGTGGGACAAAAATTGTATGGATAAACTCCAT
CCAGAATACTTGCAGAAATATTATAAGATACTTTTGCAATCTTTTGAGGA
ATTTGAACAAGAGTTTGAAAAGGAGGAAACTTACAAAGTTTACTATGGAA
AAGAAACGTTTAAAAGATTATTAAGAGGTTATTTTGAGGAAGCTCGATGG
TTGAATGAAGGATACATGCCAAGTTTGGAGGAGCATTTAAAAGTTTCTTT
GGTTACTTCTGGTTATTTCATGTTGATGGCTTGCTCTTTAGTTGGAATGA
AAAGTAACAATATTGTAACCAAACAAGTTTTCGAGTGGCTCTCCAAAGAC
CCCAAGATTGTTAGGGCAAGCGCTAGTGTTTGCAGGTACATGGATGACGT
GGCTGGTCACAAGAATGAGCAAGAGAGAAATCATATACCATCTACAATAG
AATGTTACATGAAGCAATATGGTGTATCAGAAGAAGAAGCATGTGATGAA
ATGAATAGGCGAGTGGTTATTGCATGGAAAGAAATAAACGAAGAGTTTCT
CAAACCAACTGAAGCAGCTTCACCTATATTAGTTCGTGCTCTGAATCTTG
CTAGGGTTATGGATCTTCTCTACAAAAATGGTGATAACTATACACAAGTT
GGAAAAGTCACTAAAGATAGTGTTGCTGTCTTGCTCATTGATCCAATTCC
A
Sequence Length
1701
Sequence Checksum
6eaef0fd9d1ccf913ea8fad415d14e11
Summary
Resource Type
mRNA
Organism
Name
TPS9-like2
Identifier
TPS9-like2
Time Accessioned
Friday, October 21, 2022 - 20:10
Time Last Modified
Friday, October 21, 2022 - 20:10