TPS9-like1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR036965Terpene_synth_N_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 68..240
e-value: 4.8E-180
score: 601.2
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 29..553
e-value: 4.8E-180
score: 601.2
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 241..569
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 246..514
e-value: 2.0E-97
score: 325.7
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 29..215
e-value: 9.1E-52
score: 175.5
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 10..569
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 10..569
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 29..62
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..11
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..28
NoneNo IPR availableTMHMMTMhelixcoord: 9..28
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..32
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 33..66
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..11
NoneNo IPR availableTMHMMTMhelixcoord: 15..37
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 62..78
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..39
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 40..61
NoneNo IPR availableTMHMMTMhelixcoord: 40..62
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 26..237

TPS9-like1
Sequences
Sequence
ATGTCCAACCAAATAATATTGGCATCATCAAAAAATGAGAAAATACATAA
AATTGTTCGACCAACAAAAAATTATCATCCATCTATTTGGGGAGATCGAT
TTCTACATTACAATATTTCAGAAGAAGAGTTGAGTTATAAACAAGGCCAA
GTTGAAGAATTGAAAGAAGTAGTAAGAAAGGAGATATTTGGAGAATTATT
ATGTGATGATTGGAATAATCGATTGAAGTTAATTGATGTGGTAGAACGTT
TGGGATTGTCCTATCATTTTGAGAGTGAAATACAAAATGAGCTTCAACAA
ATTTACAACAAAATAAGGATTAATGATACTAATTTAAAACATGAAACTTT
GCATGATGCTTCTATTCGGTTTAGACTTCTACGACAACATGGATACAGGG
TTTCTTTAGATATATTTGACAAGTTCAAAGATGAGAATGGCAACTTTAAA
GAATGTTTGGCGAGTGACACTCTTGGTTTGCTTAGCTTATATGAGGCCTC
ACATTTGAGTTGCGTCGGGGAAGATTTACTAAATGAAGCCTTGTCTTTTA
CGACCAGACACCTAATTGAGTTTTTGGCAAATAATAAAAAAGAACAATGC
GATGATGATGATGATCTTTTATCGAAAGAAATATCTCGAGCCCTGGAGAG
ACCCTTAAGAAAAACCCTAAACAGGCTCCAAGCTAGGCATTTCATTTCAA
TATATGAAAAAGTGGCCTTACATAACCAAGCATTGCTACAACTTGCAAAA
TTAGATTTCAATTTATTACAGTCCATGCACAAAAAGGAGCTTAGCGAAAA
CTCCAGGTGGTGGAAAGAATCAGACTTTGTACACAAATTCCCTTTTGCAA
GAGACAGGAGTGTGGAACTATACCTTTGGATATTAGCAGTCTATTATGAA
CCCCAATACTATTTGGCAAGAATAATTTTATTCAAAATTATTTCCTTTGC
CACAATAGCTGATGACATTTATGATTCATATGGTACTTTTGAAGAACTTA
AACTCCTAACTGATGTAGTTAAAAGGTGGGACATAAATGAGATTGATAAA
CTCAATCCAGGATGTTTTCAAGTATTTTATAAAGAACTTTTGATTTGTTA
TGAAGAATTTGAGCAAGGGCTTACAAAGGAAGAAACTTACAGAGTTCATT
ACGCAAAAGAAGAGTTTAAAGAATTTCTCCAAGGTTATCTGGATGAAGCT
TGGTGGTTAAAGAAAGCTGAACGCATTCCAAGTTTTGATGAGTATTTGAA
ATTTGGTTTGGTCAATTGTGGTTACTTAATGTTGACAGTGAGCTCTTTAA
TTGGAATGAAAAGTAACAATATTGTAACCAAACAAGTTTTTGAGTGGCTC
TCCAAAGGCCCCAAGATTATCAATGCATCCACTACTATTTGTCGGCTTAT
GGATGACATAGCTGAACACAAGAATGAGCAAGAGAGAAATCATGTACCAT
CTACAATAGAATGTTACATGAAACAATATGGCGTATCAGAAGAAGAAACA
TGTGATGAAATGAATAGGCGAGTGGTTATTGCATGGAAAGAAATAAACGA
AGAGTTTCTGAAACCAACTGAAGCAGCTTCACCTATATTAGTTCGTGCCC
TGAATCTTGCAAGGGTTATAGATCTTCTCTACAAAAATGGTGATAACTAT
ACACAAGTTGGAAAAGTTACCAAAGATAACGTTGCTGTCTTGCTCATTGA
TTCAATTCCA
Sequence Length
1710
Sequence Checksum
59f476ab7461390538c17c078152e933
Summary
Resource Type
mRNA
Organism
Name
TPS9-like1
Identifier
TPS9-like1
Time Accessioned
Friday, October 21, 2022 - 04:58
Time Last Modified
Friday, October 21, 2022 - 04:58