TPS64

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR036965Terpene_synth_N_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 46..46
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..26
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 27..45
NoneNo IPR availableTMHMMTMhelixcoord: 27..45
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..19
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 38..46
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 20..37
NoneNo IPR availableTMHMMTMhelixcoord: 20..37
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..31
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..11
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 32..51
NoneNo IPR availableTMHMMTMhelixcoord: 20..42
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 34..54
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 55..55
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..33
NoneNo IPR availablePANTHERPTHR31225:SF60coord: 30..513
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 30..513
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 30..189
e-value: 7.4E-178
score: 594.0
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 10..496
e-value: 7.4E-178
score: 594.0
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 192..513
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 195..459
e-value: 4.6E-97
score: 324.5
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 16..164
e-value: 1.4E-37
score: 129.3
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 7..187

TPS64
Sequences
Sequence
ATGCAAATGGCAGGAGTGAAGTTCATTAGCTACTCATCTTTATACTCGGC
TACTTTCTCAAAGAGGCCATCGAAGAAGAATTATAAGCTTCCTCGTTTTG
GTAATCCATTATTCATGTCAACAAAATGCCAGAGTATATCATCATCATCA
TCACCACCACCATTATTGTCAATAGATCATGATCCAGGGGACATAGAATG
GATTTTATTGAATAATTAGATGGTCGCTGATTATTATGACAATTATAAGA
GTACTACCTCGGAAGAGCTGTTGATCAAAAAGGTTGAAATGGCATTACGA
AAACCTACTGATGATCAAAGTTACAAAATGAGGCTCATAGATAGCATCCA
ACGGTTGGGAGTTGGCCATTATTTCGAAGAAGAAATCAAAGTAATCCTTC
AGATGTTGTCAGATTTCAATTCCGGCCAAGATGACCTCTTTAACACGGGG
CTTCGTTTTCGGCTACTCAGGCATAATGGCTTTCCAACTACCTCAGATGT
TTTTGACAAATTCATCAACCAAAAAGGAGAAATAGAGGATGTAATAATGG
GCCAAGACACATTGGGTATGCTGAGCTTGTATGAGGCATCCTACCTTGCA
GCAAATTGTGAAGAATCATTGGTGAAGGCAATGGAATTCACAAGATCTCA
TCTGAAAAGTTCGATGCCTTTCATAACCCAAAAGCTACAAAATGAAGTTG
CCAAAGCCTTGGAGCTCCCTAGACACCTGAGGATGGCACCATTAGAAGCT
CGAAACTACATCGACGAATATGGCAAAGAATTAAACCACTGCCCTGCTCT
TCTTGACTTAGCCAAGTTAGAATTTAACGAGCTTCAGTCACTCCACAAAA
GAGAATTAACCGAGATCATAAGGTGGTGGAAACAGTTGGGTCTGGTTGAG
AAACTTGGTTTTGCAAGAGATCGACCCTTAGAATGTTTTCTATGGGTAGT
GGGAATATTCCCTGGGAAATGCTATTCCAACGTCCGGATTGAGCTGGCCA
AAACTGTTTCAATCTTACTAGTCATTGATGATATCTACGACACTTACGGA
TCTTTGGATGAACTCCACTTGTTCAATCATGCAATTCTAAGATGGGATCT
TGGTGCAATGGACAAGCTTCCTGAGTACATGAAAATATGTTACATGGCAC
TATACAATACTACTAATGAAATTGGCTACAGAGTTCTCAAAGAACATGGA
TTATGCGTTACACAACACTTAAAGAAAGTGTGGTTAGACATATTTGATGC
ATTTCTAACCGAAGCAGAATGGTTCGACAAAAAATACACTCCAACTCTAG
AGCAATATTTAACAAACGGCGTAACTAGTGGAGGATCCTACATGGCCTTA
GTGCACTCATTTTTCCTCATAGGTCATGGTATTACAGACCAAACTATATC
AATGATGCACCCATATCCTGAGATCTTCTCCCACTCAGGCAAAATTCTAA
GACTTTGGGATGATTTGGGAACAGCCAAGGAGGAGCAAGAGAGAGGAGAT
GTTGCTTCTAGCATAGATTGTTATATGAAAGAAGAGAATATTGAATCGGA
AGATGAGGCCAGAAAACACATCAAGAAACTGATTAGAAGCTCGTGGATAG
AGCTAAACGGAGAGTTGAAGGCTCCTAGTGCATTGCCTCGGTCGATCACC
ACGGCCTGTTTTGACCTTGCTAGAACAGCCCAAGTCATCTATCAACATGG
AGATGATCAAAGCTTTTTAAGCGTAGAAGATCATGTACAATCTTTGTTTT
TTCGACCCTGT
Sequence Length
1761
Sequence Checksum
a330ed0cc214771c062f47c85a440fe9
Summary
Resource Type
mRNA
Organism
Name
TPS64
Identifier
TPS64
Time Accessioned
Friday, October 21, 2022 - 20:09
Time Last Modified
Friday, October 21, 2022 - 20:09