TPS38

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR001906Terpene_synth_N

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 24..210
e-value: 1.8E-47
score: 161.5
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 23..547
e-value: 2.8E-190
score: 635.0
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 237..563
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 60..236
e-value: 2.8E-190
score: 635.0
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 242..507
e-value: 1.4E-94
score: 316.4
NoneNo IPR availablePANTHERPTHR31225:SF9coord: 13..564
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 13..564
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 20..233

TPS38
Sequences
Sequence
AGTACTCCAATATTCAAAGATCAACCAGCAGCAATCGTCCGCCGATCAGG
AAACTACAAACCCACATTGTGGGATGCTCATTTTTTCCAATCACTCCAAG
TCATATATACGGAGGAAAGCTATGGGAAAAGAATCAATGAGCTGAAAGAA
GATGTGAGAAGAATTCTTGAGAAGGAGGCTGAAAATCCTTTAGTTAAGCT
TGAACAGATCAATGATTTGAGCAGACTTGGAATATCTTATCACTTTGAAG
ATCAAATTAAGACAATATTAAACCTGACATTTAACAATAATAATGTATTG
TGGAAGAAAGATAATTTGTATGCCACTGCTCTTCATTTCAAACTCCTTCG
ACAATATGGATTCAGTCCTGTATCTTCAGAGGTTTTCAATGCCTTCAAAA
ACGAGAAAAAGGAGTTCAAAGAGAGTTTGAGTAAGGATGTGAAAGGAATG
GTATGTCTATATGAGGCTTCATTCTATTCATTTAGGGGTGAACCCATATT
AGATGAAGCAAGAGACTTCACAACCAAACATCTCAAACAATACTTGATGA
CAAGGCAAAGTCAATTTACTAGAGTTGACCATCATGATGATGATGATCAT
GATCTTGTGAAATTGGTAGAGCATGCCTTGGATCTTCCACTCCATTGGAG
ATTGCCAAGATTGGAGGCTAGGTGGTTTATTGATATGTATGCTGAAAGGA
ATTATGATATGAATCCAACTTTTCTTGACTTTGCTAAACTTGACTATAAC
TTCGTTCAGTCAGCATACCAAAAAGAGCTCAAATATATTTCAAGGTGGTG
GAGTGGTTCTAGATTGACAGAAAGGCTACCATTTGCTAGAGACAGAGTAG
TGGAAATTTTCTATTCTGCAGTGGCATTGAAATATGAGGCAGAATTTGGA
TTTGTTAGAACTGTGATGACAAAAATTGGTCTCTTGCTAACACTCATGGA
CGATATATATGATGTGTATGGTACACTAGATGAGCTTCAGCTTTTTCTAG
AGGCAATTGAGAGGTGGAATATAAATGAACTGGATCAGCTACCCGATTAC
ATGAAGATATTGTTTGTTGCTTTTTATAACAATGTGAATGAGATATCTTA
TTATGTCCTTAAAGAAAATGGGATTCACATCATCAAATATCTGAAGAAAG
CGTTGGGGGATCTGTGTAAATGCTATATGGAGGAGGCAAAATGGTTTCAC
AGTGGACACATACCAAGTTTAGAAGAATTCATTGAGAATGGATGGAAATC
AATTACAATACCTCTTTGTCTTATCTATCATTATTGCTTAATTACAACTT
CAATTACAGAACAAGACATGGAACACTTGCTTCAATATCCAACCATTTTA
CGTGTCTCAGGAACTGTTTTTCGATTTATAGATGATTTGGGAACCTCATC
AGATGAACTTGAAAGAGGAGATAATCCTTCATCAATTCAATGCTACATGC
GTGAAAAGGGTGTTAGTGAAAATGAAAGCCGTGAACACATATGGAATTTA
ATTAGTGAAGGATGGAAGGAAATTAATGAAGTTAAAGCTTCAAACTCTCC
ATACTCTCAAGTGTTTATTGAATCTGCCATTGATTTTGTTAGAGGAGCAA
TGGAGATGTACCACAAGGGTGATGGTTTTGGTACTAATCAAGACCGATAT
CTTAAGACCAAAGTTGTCAACATGTTCTTCGATCCAATTCCAATT
Sequence Length
1695
Sequence Checksum
9f62e94e31a8ea8003e62b44c5cd323a
Summary
Resource Type
mRNA
Organism
Name
TPS38
Identifier
TPS38
Time Accessioned
Thursday, October 20, 2022 - 22:18
Time Last Modified
Thursday, October 20, 2022 - 22:18