TPS49

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 10..527
e-value: 5.5E-207
score: 690.1
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 218..541
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 223..488
e-value: 4.1E-112
score: 373.9
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 49..217
e-value: 5.5E-207
score: 690.1
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 10..192
e-value: 8.4E-58
score: 195.2
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 1..542
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 1..542
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..30
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 4..23
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 31..60
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 24..30
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..3
NoneNo IPR availableTMHMMTMhelixcoord: 4..26
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 25..48
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..24
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 7..218

TPS49
Sequences
Sequence
CGTCGATCGGCCAATTTTCATCCTAGTATCTGGGGAGATCACTTTCTCAA
ATATACCCATCAATCATTGGAAGTTGATGATAATACAAAGCAAGAAGTTG
AAAAACTAAAAGAGGAAGTGAGAGGGATGCTAACTGCTGCCCCCAGCATT
AATTCTTCCCAAAAGCTACAGTTAATTGATACAATCCAACGGTTAGGAGT
CGCTTATCATTTTGAGAGCGAAATCAGTGACATTTTGGGAAAAATGAAGA
AAATCAATCCTCACACTGAATTGGATAATAGTACCCTTCATACGGTCTCC
CTTTGGTTTCGATTGCTTAGACAACAAGGATACAACATATCAAGTGATAT
ATTTGAGAAGTTTACAAACAAAAAAGGAAAACTGGACGATAGTGTTAGTA
GTGATGTTGAAGGAATGCTAAGCTTGTATGAAGCTTCACATATGAGAATC
CATGGAGAGCCTATACTTGAAGAAGCAGTAGTTTTCACCACAACTCATTT
GGTGGAGGCCTCTAAGGAGAAATCCCAGTTGACCATGAGCTCATTATTTC
TTGCGGCACAAGTCAACCATGCCTTAAGACAGCCCATCTTGAAGGGCTTG
CCAAGAGTAGAAATTCAACGCTTTATTTCTCTCTATCATCACGACCCTAA
CCACAGTCATCTTTTGCTTCGCTTTGCTAAATTGGACTTCAACGTTCTCC
AAAAGTTGCACCAGAAGGAACTTCATGAAATTTCAAAGTGGTGGAAAGAC
TTGGACTTTGCATCGAAGCTACCTTTCGCACGTGACAGACTAGTCGAGGG
TTATATTTGGCCTGTGGGAGTATACTTTGAGCCAAAGTACAGTGCTGCTA
GGGTTATATTGACAAAAGTAATTGGTGTGACAACAATGATTGATGACATT
TATGATGTTTATGGAACTTTAGAAGAACTGGAACTCTTCACAGACGCAAT
AGAAAAGTGGGATATAAGCTGCAGTGATCAACTCCCTGATTACATGAAAT
ATTGTTACGAGGCACTGTTAAAATTATACGATGAAATTGAGGAGGAGTTG
GCCATGCAAGGCAGAACTTATCGGATGGCCTATGCAAAGGAGACAATGAA
GAAGCTAGCTCAATCCTACTACGTGGAAGCTCAATGGTTTCATAAAAAGT
ACACACCAACGTTACAGGAATATATGGAGGTTGCACTGGTGTCATCCACG
TACTACATGCTCACTGCCACGTCATTCCTAGGAATGGGAGAAGAAGTCTC
AGCTGAGGTCTTTCATTGGCTTATGAACTCTCCTAAGATTGTAACAGCAT
CAGCAGTAGTTTGCAGACTCATGGATGATGTGGTCAGCCACAAGTTTGAG
CAAGATAGAGGACACGTGGACTCTAGCGTGGAATGTTATATGAAGCAATA
TAATGTAAGAGAAGAAGAAGCGTGCAAAGAATTGAAGAAACAAGTTTTAG
ATGCATGGAAAGAAATGAATGAGGAGTGCATGGAGCCAAGAGATGTGCCC
ATGTCTGTCCTCATGCGCGTGGTCAATCTCGGACGAGTGATCGATGCTGT
TTACAAAGATGGAGACGGTTACACCCATGCCGGAGGAATCATGAAGACTT
TTGTCAAATCTTTGTTTATTCAAACTCTTCCCCTC
Sequence Length
1635
Sequence Checksum
147f3de82298e6e33796d7b0a2da5d9b
Summary
Resource Type
mRNA
Organism
Name
TPS49
Identifier
TPS49
Time Accessioned
Friday, October 21, 2022 - 20:09
Time Last Modified
Friday, October 21, 2022 - 20:09