TPS11-like

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 45..60
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 61..61
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..44
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..25
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 26..43
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 44..56
NoneNo IPR availableSIGNALP_EUKSignalP-noTMSignalP-noTMcoord: 1..12
score: 0.494
NoneNo IPR availableTMHMMTMhelixcoord: 20..39
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 40..40
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 17..39
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..16
NoneNo IPR availableTMHMMTMhelixcoord: 17..39
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 24..61
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..23
NoneNo IPR availableCOILSCoilCoilcoord: 52..72
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 20..572
NoneNo IPR availablePANTHERPTHR31225:SF9coord: 20..572
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 28..37
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..27
NoneNo IPR availableTMHMMTMhelixcoord: 5..27
NoneNo IPR availableTMHMMTMhelixcoord: 10..32
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 30..557
e-value: 9.1E-182
score: 606.9
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 242..571
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 30..188
e-value: 2.0E-43
score: 148.3
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 247..519
e-value: 1.7E-95
score: 319.4
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 67..241
e-value: 9.1E-182
score: 606.9
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 28..242

TPS11-like
Sequences
Sequence
TCAAGTGCATGCTACCCCATCATATGTGCTGTGGTCAATAGTTCTAATGC
AATTATTGATCGACGATCTGCCAACTTTGAGCCCTCCATTTGGTCTTTTG
ATTATATTCAATCTCTTACAAGCCAATATAAGGAAGAATCTTATACAGGT
CGAGTCAAAGAATTGGAGATAGATGTGAAAAAGATGTTAATTGAGATGGA
AAATTCTTTAATTCAACTTGAACTCATTGACACATTGCAAAGACTTGGAG
TATCTTATCGTTTTGAGGATGAAATAAATACTATTTTGAAAGAAAAATAT
ATTAATATGATCAATAACCCTAATTATAATAATTTATATGTCACTGCTCT
TGAATTTAGGCTTCTACGTCAACATGGCTATGCAGTACCTCAAGAGATTT
TTAATCATTTTAAGGAAGAGATAGGAAAAATCAAAGCGAACATGATTAGT
GATGATATTATGGAAGTATTGGCCTTATATGAAGCTTCATTCTATGAGAA
AAAAGGCGAAAGTATTTTAGAAGAAGTTAGAATTTTCACAACTCAATATC
TAAAGAACTACATTATAATGATATCACAAGAAAGAAAGTTAATGATTGAT
AATGATAATGATTATGATTATGATATCGAAATAGTGAATCACGCTTTGGA
GCTCCCACTTCATCGGAGGACTACAAGAACAGAAGCTAAGTGGTTCATCG
ACGCGTATGAGAAAAAACAAGACATGAATCCTATTTTGCTTGAGTTTGCT
AAACTCGATTTCAACATGATACAATCAACACATCATGACGATCTAAAACA
TATATTCAGGTGGTGGAGGCATACTAAACTTGGGGAGTTGAATTTTGCAA
GAGATCGATTGATGGAATGTTTCTTATGGAAAATTGGAATAAGATTTGAG
CCAAAATTCAGTTATTTTAGAATAACAACTGCCAAATTATTTGAGCTAAT
AACAGTAATTGATGATATATATGATGTTTATGGAACATTGGATGAATTAG
AGCTTTTCACCAAAGCTATTGAGAGATGGGATATGGAAATGATAAATGAG
TTACCAGAATATATGAAGATGCCTTATATTGTTTTACACAATACCATTAA
TGAAATGGTATTTGAGGTATTAAGAGACCAACACATCTCCATCAACATTC
AATACCTTAAGAAAACGTGGGTAGATATGTGTAGAGGTTTTTTACAAGAG
GCAAAATGGTACTATAGTGGATATACACCAACACTAGAAGAATATATTAA
AAATGGTTGGATTTCAGTGGGAGCACCGGTTCTAATTGTGCATGCTTATT
TTTCTCATGCAAATTATAATCACACAGTTACAAGTAGTAAAGAGATTTTC
GAATGCTTTGAACATGGTTATTATCCCGCCATAATTCGTCATAGTGCCAT
AATATTACGACTTACAAATGACCTAGCAACATCATCGGAGGAACTGAAAA
GAGGTGATGCTCCGACATCAATTCAATGTTATATGCAAGAAAAAAAAGTA
TCTGAGGAGAAAGCTCGTGAACATATTAAGTTTTTAATAAGTGAAATATG
GAAAGAGATGAATAATGATGTTGGATTATATCCAATCTCATTGATTGAAG
ATGCTACAAATTTTGCTAAGATGGGATTTTTCATGTATCAGCATGGTGAT
GGTCATAGTTCTCAAGATAATCAATCCAAACAAAAAATTTCATCCTTGAT
TATTGAACCTATTCCCTTA
Sequence Length
1719
Sequence Checksum
cd04137c72105ae00d308d98ee784615
Summary
Resource Type
mRNA
Organism
Name
TPS11-like
Identifier
TPS11-like
Time Accessioned
Wednesday, October 19, 2022 - 16:23
Time Last Modified
Wednesday, October 19, 2022 - 16:23