TPS9

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 15..26
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 3..14
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 27..56
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..2
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..26
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..19
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 20..43
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 44..56
NoneNo IPR availableTMHMMTMhelixcoord: 21..43
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 7..555
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 7..555
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..10
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 22..25
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..25
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 11..21
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 26..85
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 235..500
e-value: 8.2E-106
score: 353.2
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 66..229
e-value: 1.0E-189
score: 633.1
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 28..540
e-value: 1.0E-189
score: 633.1
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 230..554
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 28..204
e-value: 2.3E-52
score: 177.5
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 25..226

TPS9
Sequences
Sequence
ATGTCATATCAAGTTTTAGCCTCATCACAAAATGACAAAGTATCAAAAAT
TGTTCGTCCAACAACAACTTATCAACCTTCTATTTGGGGGGAGAGATTTC
TCCAATATAGTATTTCAGACCAAGATGTAAGCTATAAAAAGCAGCGAGTT
GACGAATTAAAGGAAGTGGTAAGGAGAGAGGTATTTTTAGAATGTTATGA
TAATGTTTCATATGTGTTGAAGATAGTGGATGATGTTCAACGTTTGGGAT
TGTCGTATCATTTTGAAAGTGAAATAGAAAGAGCGCTACAACACATTTAC
GATAACACTATTCATCAAAACCACAAAGATGAAGATTTACATGACACTTC
TACCCGCTTTAGACTATTGCGCCAACATGGATTTATGGTTTCATCTAATA
TATTTAAAATATTTAAAGATGAGAAAGGGAATTTTAAGGAGTGCTTGATA
ACTGACATTCCCGGTTTGTTGAGCTTATATGAGGCCTCACAGTTAAGCTA
TATTGGAGAGAATATATTAGATGAATCACTTGCTTTCACCACCACTCACC
TTCATCAGTTTGTGAAAAATGAAAAAACACATCCATTATCAAATGAAGTA
TTACTAGCCTTGCAGAGACCTATAAGAAAGAGCCTAGATAGGCTCCACGC
TAGGCATTACATTTCATCTTACGAAAACAAGATTTGTCATAACAAAACAT
TGCTAGAACTTGCAAAGTTGGATTTCAATCTATTACAATGTTTGCATAGA
AAAGAGCTTAGTGAAATTTCCAGGTGGTGGAAAGAAATAGACTTTGTACA
CAAACTACCTTTTGCAAGAGATAGGATTGTGGAGCTATACCTTTGGCTAT
TAGGAGTTTTTCATGAACCTGAATTTTCACTTGCAAGAAATATTTCAACA
AAAGTCATTGCATTGGCCTCAGTTGCAGATGATATTTATGATGCATATGG
TACATTTGAAGAGCTTGAGCTCCTTACTGAATCAATTAATAGGTGGGACT
TAAATTGTGCGGATCAACTACGTCCAGAATGTTTACAGACATTTTATAAG
GTTCTTTTAAATTGTTATGAAGAATTTGAGAGTGAGCTTGGAAAGGAGGA
AAGTTACAAAGTTTACTATGCAAGAGAAGCGATGAAAAGATTACTTGGAG
CATATTTCAGTGAAGCTCGATGGTTGCACGAAGGATATTTCCCTAGTTTC
GATGAGCATTTGAAGGTTTCATTGATTTCTTGTGGATACACCATGATGAT
AGTGACCTCTTTAATTGGAATGAAAGATTGTGTAACAAAACAAGATTTTG
AGTGGCTCTCAAAAGACCCCAAGATAATGAGAGATTGCAATATCCTTTGT
AGGTTCATGGATGACATAGTCTCTCATAAGTTTGAGCAACAAAGAGATCA
TTCACCGTCTACCGTTGAGAGTTACATGAGGCAATATGGGGTGTCAGAGC
AAGAGGCATGTGATGAGCTAAGAAAGCAAGTGGTTAATTCATGGAAAGAA
ATAAACAAAGCATTCCTCAGGCCTTCTAATGTGCCTTATCCAGTTTTATC
TCTTGTTCTCAATTTTTCGAGAGTAATGGATCTTCTCTACAAAGATGGTG
ATGGCTATACGCATGTTGGAAAAGAGACAAAAAATAGTGTTGTTGCGTTA
CTTATAGATCAAATCCCA
Sequence Length
1668
Sequence Checksum
9cece02af3ea965482739d3b0453e708
Summary
Resource Type
mRNA
Organism
Name
TPS9
Identifier
TPS9
Time Accessioned
Thursday, October 20, 2022 - 13:34
Time Last Modified
Thursday, October 20, 2022 - 13:34