TPS20

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 69..85
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..50
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 51..68
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 21..44
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 45..54
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..20
NoneNo IPR availableTMHMMTMhelixcoord: 21..43
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..32
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..11
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 33..38
NoneNo IPR availableTMHMMTMhelixcoord: 10..32
NoneNo IPR availableCOILSCoilCoilcoord: 349..369
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 6..549
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 6..549
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 28..533
e-value: 9.7E-188
score: 626.6
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 223..551
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 29..197
e-value: 1.3E-50
score: 171.8
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 228..493
e-value: 2.5E-102
score: 341.8
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 65..222
e-value: 9.7E-188
score: 626.6
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 25..223

TPS20
Sequences
Sequence
ATGTCAAATATTCAAGTCTTAGCTTCATCTCAATTATGTGACAAAATTAT
TGCTCGCCCAACAACAAAATTTCACCCTTCTATTTGGGGTGATCGATTCC
TCCATTACAATATTTCAGAACAAGACTTGGTTTGCAAACAAGAAAGAGTT
GAAGAATTAATACAAGTTGTAAAGAAAGAGATATTATCTTCAAATCATGA
TCAATTGAAGTTGATTGACAATCTCCAACGTTTGGGATTATCATATCATT
TCGAGAGTGAAATCGAGAAATTATTGGAACTATTAAGTATCGGCACTCAT
CATCAAAATAATAATCTACATGATGTTTCTCTTCGGTTTAGACTATTAAG
ACAAAGTGGATTTAAGGTTTCATCAAGCATATTTGAAAAATTCAAAGACG
AGAAAGGTAACTTTAAAGAAAGCCTAATAACCGATGTTTCAGGTTTGCTT
AGCTTGTATGAGGCTTCGCACTTGAGTTATGTTGGAGAAAGCATACTAGA
TGAAGCACTTGCTTTCACAACCACTCACCTTAAGGCTATTGTGGCAAATA
ATAAAGATCATCCATTATCACATCAAATATCCATAGCCTTGGAAAGGCCT
CTAAGAAAGACCATAGAGAGGCTTCATGCTAGGTTTTACATCTCAATCTA
TGAAAAGGATGCCTCTCATAACAAACTATTGCTAGAGCTTGCAAAGTTAG
ACTTCAATGTACTTCAATGTTTCCACGAAAAGGAACTTAGTGAAATTATG
AGGTGGTGGAAGGAGCATGAGTTTGTAAAGAAATTCCCTTTTGCAAGAGA
TAGGATGGTGGAACTATATTTTTGGATATTGGGTGTATATTATGAACCCA
AATACTCTCGAGCAAGAAAGCTTTTGACCAAAGTCATTGCATTGACCTCA
ATCACTGATGATACTTATGATGCATATGGTACTATTGATGAGCTTGAGCT
TCTTACCAAAGCAATTCAAAGGTGGGACATAACTTGTATGGATAAACTTG
AGCCAGAATATTTAAAGACATATTATAAGGTAATGTTGGAATCTTATGAA
GAATTTGAAAAGGAGCTTAAAAAGGAAGAATTATACAAACTCGAGTATGC
AAAAGAAGAGATGAAAAGAACTATTGGAGGTTATTTTGAAGAAGCTCGAT
GGTTGAATGAAGGATATTTCCCAAGCTTCGATGAGCATTTGAGAGTTTCA
TATGTTTCTTCTGCTAACGTTTTGTTGATAGCCACAAGTTTTGTAGGAAT
GCATGATATTGTAACACATGAAACTCTAGATTGGCTCTCTAAAGACCCTA
AGATTGTTTCAGCTTCCACTCTCCTCTCAAGATTCATGGATGACATAGGC
TCTCGCAAGTTTGAGCAAGAGAGAAATCACATACCATCTACAGTGGATTG
TTACATGAAACAATATGGAGTATCAGAGGAAGAGGCAATTAAAGAACTTA
ATAAAAGAGTGATCACCCACTGGAAAGAAATTAATGAAGACTTTATTAGG
CCAACTGTTGTGCCTTTTCCTATCTTACTTCGTGTTCTTAATTTTACAAA
AGTAATAGATCTTTTTTACAAAGAGGGTGATGATCAATACACACGTGTTG
GAAAAGCGCTCAAAGAAAGCATTGATGCTTTGCTTATAGATTCAATCCCA
TTA
Sequence Length
1653
Sequence Checksum
14d79d02ea8bf3e8b085101dad68b5eb
Summary
Resource Type
mRNA
Organism
Name
TPS20
Identifier
TPS20
Time Accessioned
Friday, October 21, 2022 - 20:08
Time Last Modified
Friday, October 21, 2022 - 20:08