TPS13-like1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR001906Terpene_synth_N

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 28..39
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..27
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..19
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 20..36
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 37..42
NoneNo IPR availableSIGNALP_EUKSignalP-noTMSignalP-noTMcoord: 1..19
score: 0.52
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 47..51
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 26..46
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..25
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 7..29
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 30..46
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..6
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 30..50
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..29
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 51..59
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..15
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 35..42
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 16..34
NoneNo IPR availableTMHMMTMhelixcoord: 15..34
NoneNo IPR availableCOILSCoilCoilcoord: 75..95
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 31..619
NoneNo IPR availablePANTHERPTHR31225:SF74TRICYCLENE SYNTHASE, CHLOROPLASTICcoord: 31..619
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 62..217
e-value: 1.9E-47
score: 161.4
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 57..287
e-value: 2.7E-72
score: 244.8
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 278..545
e-value: 2.7E-96
score: 322.0
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 288..619
e-value: 1.4E-125
score: 420.4
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 273..617
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 53..270

TPS13-like1
Sequences
Sequence
AATAGTAATAATAATAATGCCTTCACTAGATCTGTGAAATCATGTTTAAG
TTCAAACCATAATAATTATAATATTATTCATAATAAAACTGTATTAATGT
CTACCAATAATAATAATAATAATAATAATATTATTTCTCGAAGATCAGCA
AACTATCAACCTTCACTTTGGCATTTTGATTATGTACAATCACTTTCTAC
CCCTTTCAAGGAAGGAGCATATGCCAAAAGAGTTGAGAAAGTAAAAGAAG
AGGTAAGGGTAATGGTGAAGAGAGCAAAAGAGGAAGAGAAGCCTTTATCT
CAACTTGAGCTAATTGATGTATTGCAAAGACTTGGAATCTCTTATCACTT
TGAGGATGAAATTAATGATATATTGAAACATATATATAACAACAATAATG
TGTACAACACCAACAATAATGTGTATGCCAATTCTCTTGAATTTAGACTC
CTAAGACAACATGGTTATCCGGTGTCTCAAGAAATTTTTAGTACGTGCAA
AGATGAAAGAGGCAATTTTATGGTGTGTACCAATGATATCAAAGGAATGT
TATCTTTATATGAAGCTTCATTCTATTTGGTAGAAAATGAAGATGGTATT
TTGGAAGAGACAAGAGAAACAACAAAGAAATATCTTGAGGAATACATAAT
CATGATCATGGAAAAACAACAATCATTATTAGATCAAAATAATAATAATA
ATGATAATGATTATGATTATGAACTAGTGAGCCATGCATTGGAGCTTCCA
CTTCATTGGAGAATGTTAAGATTGGAGAGTAGGTGGTTTATTGATGTGTA
TGAGAAGAGACTAGACATGAACCCTACTCTACTTACCTTAGCTAAACTAG
ATTTCAACATTGTCCAATCAATATACCAAGATGATCTTAAACATGTCTTC
AGCTGGTGGGAAAGCACTGGTATGGGAAAGAAGTTGGAATTTGCAAGAGA
TAGAACAATGGTGAATTTCTTATGGACAGTAGGAGTTGCATTTGAGCCAC
ATTACAAAAATTTTAGAAGAATGATTACAAAAGTAAATGCTTTAATTACA
GTAATAGATGACATATATGATGTTTATGGTACACTAGATGAATTGGAGCT
CTTCACTAATGCAGTTGAGAGATGGGATATTAGTGCTATGGATGGGCTCC
CTGAGTATATGAAGACATGTTTTCTTGCTTTATACAATTTCATAAATGAT
CTTCCATTTGATGTGTTAAAAGGAGAAGAAGGCCTCCATATAATAAAATT
CCTTCAGAAATCGTGGGCAGATCTTTGCAAATCTTATTTAAGAGAAGCAA
GATGGTATTATGATAGATACACACCAAGTTTTGAAGAGTACATTGAAAAT
GCATGGATATCAATATCAGGACCTGTTATACTATCACATTTATACTTTTT
TGTAGTGAATCCAAACAAGGAAGATGCCTTATTAAGTACTTGCTTTGATG
GATACCCTACCATAATACGACATTCATCGATGATTTTACGTCTTACAGAT
GATCTTGCAACTTCAACGGATGAACTGAAAAGAGGCGATGTTTCTAAATC
AGTCCAATGCAAAATGCATGAAGATGGCGTGTTTGAAGAAGAAGCTCGTC
AACATATTAAGTTATTAATAAGTGAAACATGGAAGCTTCTTAATAAAGAT
TACATAAATTTGGATGATGATGATGATGGTGATGACTACTCTCCAATGTT
CTATAAGTCTAATAATATTAATAAGGCTTTCATTGAAATGTGTTTAAACC
TTGGTAGAATGGCACATTGCATTTATCAATATGGAGATGGACATGGAATT
CAAGATCGCCAAACAAAAGATCATGTACTATCATTACTTATTCACCCTAT
TCCACTTACCCAA
Sequence Length
1863
Sequence Checksum
5b2f4948087da6d792f32ff43b7aef52
Summary
Resource Type
mRNA
Organism
Name
TPS13-like1
Identifier
TPS13-like1
Time Accessioned
Thursday, October 20, 2022 - 03:57
Time Last Modified
Thursday, October 20, 2022 - 03:57