TPS60

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..31
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 51..64
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 32..50
NoneNo IPR availableTMHMMTMhelixcoord: 29..51
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 6..529
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 6..529
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 395..531
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 373..394
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..372
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..19
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 20..42
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 43..52
NoneNo IPR availableTMHMMTMhelixcoord: 20..42
NoneNo IPR availableSIGNALP_EUKSignalP-noTMSignalP-noTMcoord: 1..33
score: 0.503
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 197..474
e-value: 4.9E-86
score: 288.4
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 7..206
e-value: 9.2E-67
score: 226.3
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 7..166
e-value: 2.5E-53
score: 180.7
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 207..531
e-value: 1.7E-99
score: 334.7
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 192..530
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 12..191

TPS60
Sequences
Sequence
ATGAAGGAAAATAATGATGATAGTGAAATAGTTATTCTGAAGAAAGAAGT
GAAGAAGAAAATACTTGAGCTTGACTATGTTGAAAACCCATTAGAGACAC
TTGAATTTATTGATTCAATTCAACGATTGGGAGTGTCGTACTATTTTGAA
AATCAAATTGAAGTAGTTTTGAAGAACATATGTAACAAATTTCACGAGGA
AAATAATGACGACGGTGATCTTTATGTTGTTGCTCTTCGATTTCGATTGG
TTAGACAACAAGGTTATTACATGTCATGTGACGTGTTCAACAAGTTCACG
AACAATGAAGGAAAATTCAAAGAGTCACTTTTTAACGATATTCGAGGAAT
GTTAAGCTTATATGAGGCTTCACAACTAAGAGTGCATGGAGAGAAAATAC
TAGATGATGCCCTAATATTCACAACAAATCACCTCGAATCTGGAGCTAAA
ACCTCGAAATTAAGCTCTCATATTTCAAACCAAGTAAATCACGCGTTGAA
AAACCCTATTCGAAAGAGCTTGCAAAGGAGACAGGCTAGACATTACATGT
CTTTATACCATCAAATCTCTTCTCACAATGAGCATCTTCTAGCTCTAGCT
ATACTAGATTTCAACTTGCTACAAAAACTTTACCAGAAGGAATTAAGTGA
TCTCACAAGGTGGTGGAAGAAGTTTGATTATGAAAGAAGGCAATCGTTCT
CTAGAGAAAGAATAATGGATTGTTACTTTTGGACTTTTGGAGTGTTTTTT
GAGGCTCAAACCTCACATATTAGGTTGCTGATGAGCAAGTTGATTGCTTT
GCTCACTCTTGTTGATGATATTTATGATAACTTTGGAACTTTTCAAGAGC
TACACCTCTTAACTGAAGCAATACAAAGATATATATGTATATATATATAT
ATGAGTAGGTGGGATATGTGTTTGATTGATCAACTACCAGAGTACATTCA
ACCATGTTACAAGGAAATCTTGAATCTTTACACTGAAATTGGAGAATTTA
CTAAGGACAAATCATATTGCCTTAGCTACGCTAAGAAAGGATTCCAAGAG
CTAGTAAAAGGGTACTTTGAGGAAGCCAAATGGTTACACCAAAAACATAA
TCCAACACTAGATGAGTATATGCCAATTGCACTTGTTACTGCTGCTTCTC
CTCTACTCATTGCTATTTCATTTATTGGAATGCCAAATGTTGTTACAAAA
GATTCTATGAATTGGATCTTTTCTCATCCACAGCCTAAAAGTGTGCGGAC
TCTGTCGATCGTTGGTAGAGTTCTTAACGACATTGGCTTCCACCAGTGGA
GGGAAAGGAGAACAGAGAAAGTAGATTTTTCAGCTGTGGATTGTTATATA
AGACAATATGGTGTGGAAGAAGAAGAAGCAATACAAAGACTTAAAGAACA
AGTTAGTGATTCATGGAAAGATCTGAATGAAGAGTGTCTCTATCCCAACA
ATATGAATATCCCAATGCCACTTCTAATGAGAGTTCTTGATCTTGTACGG
ATGAATAATGAATTATACAGAGAAGGAGATGGTTTTACAAGAGAAGCTTT
CATCAAAGATTTGATTGATTCTCTCATCATCAATCCCTACATC
Sequence Length
1593
Sequence Checksum
603e84e5765cefae404d3abc544d6e57
Summary
Resource Type
mRNA
Organism
Name
TPS60
Identifier
TPS60
Time Accessioned
Thursday, October 20, 2022 - 11:38
Time Last Modified
Thursday, October 20, 2022 - 11:38