MT295506.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR001906Terpene_synth_N

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..26
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 27..46
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 47..51
NoneNo IPR availableTMHMMTMhelixcoord: 27..46
NoneNo IPR availableGENE3D1.50.10.160coord: 110..322
e-value: 7.3E-198
score: 659.6
NoneNo IPR availablePANTHERPTHR31739FAMILY NOT NAMEDcoord: 52..807
NoneNo IPR availablePANTHERPTHR31739:SF4ENT-COPALYL DIPHOSPHATE SYNTHASE, CHLOROPLASTICcoord: 52..807
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 52..52
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 29..51
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..28
NoneNo IPR availableTMHMMTMhelixcoord: 29..51
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 80..114
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 133..138
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..59
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 60..79
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 115..132
NoneNo IPR availableTMHMMTMhelixcoord: 60..79
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 267..473
e-value: 2.6E-51
score: 174.0
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 91..525
e-value: 7.3E-198
score: 659.6
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 517..674
e-value: 1.7E-23
score: 83.3
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 527..810
e-value: 6.9E-81
score: 273.6
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 512..722
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 107..189
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 278..498

  • Cannabis sativa cultivar Purple Kush terpene synthase 66 mRNA
  • partial cds
Sequences
Sequence
CCTTTCTCTCAAAACACTAATACTCTCTCCCTTTTCCATCAACCAAAACT
TCTTCCTCCAGGTGCTTCGCTATTGGAAGCTAAAGACAAACAAGTTAACT
TTGATCGTGATATTCGCTCAAAATGCAGCGCTATATCAAAACCCCGCACT
CACGACGTGTTTCAAAGTGGTGGTCTGCCAGTTATAAAGTGGCACGAGAT
TGTGGAGGATGACATAGATGGAGAAGAAGAAGATACTAAGTGGACAAGAT
CGAATGAGATCGAGGAACGTGTCGCTTCAATCAAATCAATGTTGGAGAGT
ATGGATGAGGGAGAGATAAGCATTTCAGCGTACGACACAGCATGGGTAGC
CCTTGTGGAAGATATTCATGGGAGTGGCTTACCTCAATTCCCATCGAGTC
TCCAATGGATCGCCACACATCAGCTCTCCGACGGTTCTTGGGGCGATGCT
GACATTTTCTCCGCACACGATCGCCTCATCAACACTTTGGCTTGTGTTGT
TGCTTTGAAATCTTGGAACCTTTATCCCGAAAAATGTCAAAAAGGTATGG
CCTTTTTCAATGCAAATATAAGTAAGCTTGAGAGGGAGAATCCGGAACAC
ATGCCTATTGGTTTCGAAGTGGCTTTCCCTTCTTTACTTGAAATAGCTCG
AAAATTAAACCTTGAAGTGCCTGAGGATTCTCCTGTGTTAAAAGTCATAT
ATGCTAGGAGAGATTTCAAGCTCACAAGGATTCCGAGGGACATAATGCAC
ACAGTGCCCACGACGCTACTCCATAGCTTGGAAGGAATGGTAGGTCTGGA
CTGGGAAAAGCTTTTGAAACTGCAGTCCCAAGATGGGTCATTCTTGTTCT
CACCATCCTCAACTGCTTTTGCACTCATGGAGACCAAAGACCGAAATTGC
TTGCAATATTTAACTAAAGCGGTCCAAAGGTTCAACGGGGGTGTCCCAAA
TGTTTACCCGGTTGACTTGTTCGAGCACCTTTGGGTTGCGGATCGGTTGC
AGCGCTTGGGAATATCAAGATTCTTTGAGCCACAAATTGAGGAATGTATC
GATTATGTATTCAGAAATTGGACTGAGAAAGGAATTGGCTGGGCAAGAAA
TTCCAAGGTTGAAGATATTGACGATACAGCAATGGGTTTCAGACTACTAA
GATTGCATGGTCACAAAGTTTCTGCCGATGTGTTCCAACACTTTAAGAAA
GGTGACGATTTTTTCTGCTTTCGGGGCCAGTCAACTCAAGCAGTGACTGG
GATGTATAACCTTTTTAGAGCTTCTCAGTTGGTTTTCCCTGGAGAAAAAA
TTCTTGAAGATGCCATGGAATTCTCATCGAAATTTCTTAGAAAAAAACAG
GCGTCCAATGAATTGCTAGATAAATGGATCATAACAAAGGACTTACCTGG
TGAGGTGGGTTTCGCATTGGAGGTTCCATGGAATGCAAACTTACCTCGAG
TAGAGACCAGATTCTACATTGAACAGTATGGTGGACAAAATGATGTTTGG
ATTGGCAAGACACTCTACAGAATGCGAAAAGTTAACAATGACGAATATCT
AGAGTTAGCAAAACTTGATTACAACATTTGCCAAGCTTTGCATTCGATTG
AGTGGCACAATTTGCTAAAATGGTACCGAGATTGTAAGTTGGAAAATTAT
GGAGTGAGCAGAAGGAACCTCCTCTTGGCCTATTTTCTTGCTGCGGCCAG
TATTTTCGAACCGGAGAGGGCCGATGAGCGGCTTGCATGGGCTAAAACGG
CAGCACTGATGCAGGCCATCCAATCTCATTTCGATGACCAGAAAGCTTCT
TCGGAGCATCGTATAGCTTTTGTCTCTGCTTTTAAAAGGAGTTGTAACAT
GCCATCGTATTTGATTACAAGGGTGTCGAACATAAGTGATACAGATCATG
GCCTTCTTAGAACGTTGATGACGACTCTCAGCCACCTCTCTTTGGACACA
ATGATGCTGTATGGTCGGGACATCACCCACCATTTACGTCAAGCTTGGGA
AAAGTGGCTGGTGAAGTGGCAAGAGGGTGGTGATGGACATTACGAAGAAG
AAGCAGAATTATTGATCCAAACAATAAACCTTAGCTCAGGCCGTACACTT
GTGAAGGCCCTCTTGCTGTCAAATCCTCACTATGAAAAACTCTTCAGTAC
CACAAACAAAGTTTGCTGCAAAATTCGTCACTTTCAAAGACAAAGGCATA
GGGCCAAGGCAAATCAAAATGGAGAATTTAACAGAAACATCTTAACACCA
GAAATAGAGTCAGATATGCAAGAGGTTGTGCAATTGGTGCTACAAAAATC
TTCAGATGACATCAACACAAAAATTAAGCAGACATTTCTACTGGTGGCCA
AGTCTTTTTATTATGCTGCCTACTGTGATTCTAAGACCATCAATTTCCAC
ATTGGCAAAGTAATATTTGAGACTGTGGACTGA
Sequence Length
2433
Sequence Checksum
31adead08993adb3fb5e28af4f02be02
Summary
Resource Type
mRNA
Accession
MT295506.1
Organism
Name
MT295506.1
Identifier
MT295506.1
Time Accessioned
Friday, October 21, 2022 - 20:07
Time Last Modified
Friday, October 21, 2022 - 20:07