TPS58

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR036965Terpene_synth_N_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 24..42
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..23
NoneNo IPR availableTMHMMTMhelixcoord: 4..23
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 30..51
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..29
NoneNo IPR availableTMHMMTMhelixcoord: 5..27
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 26..45
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..25
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 46..49
NoneNo IPR availableTMHMMTMhelixcoord: 20..42
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 1..484
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 1..484
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 1..174
e-value: 3.0E-64
score: 218.1
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 165..430
e-value: 3.0E-101
score: 338.3
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 1..134
e-value: 1.7E-47
score: 161.6
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 175..484
e-value: 5.8E-114
score: 382.2
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 160..484
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 1..156

TPS58
Sequences
Sequence
CTTGAATATATTGATGATATTCAACGATTGGGGTTGTCTTATTATTTTGA
AAATGAAATTGAACAAATTTTGGAGCAATTTCATAATAATTATCAAAATC
TAATTGATTTTGGTGATAATAACCTTTATGCTGATGCTCTTTGCTTTCGG
TTGCTTAGGCAACAAGGTTATAATATTGCATGTGACATATTCGACAAGTA
CAAGAATGAAAAAGGAAAATTTAAAGAATCAATTTCGAGTGACATTCGAG
GAATGTTGAACTTGTATGAAGCTGCACAAATGAGAGTTCATGGAGAGAAA
ATACTAGACGAAGCACTTATCTTTACAACTACTCATCTTGAATCCTCAGT
TAAAACATGTCAATTGAGCTCTCCTTATCTAGACCTAGTGAAACATGCCC
TAATGCACCCTATTCGAAAGAGCTTACAAAGAAGAGAGGCAAGACTTTAC
ATATCACTTTATCATCAACTACTTTCTCATGAGGAGATTCTTTTAACACT
TGCTAAATTAGATTTCAACTTGCTTCAAAAACTACATCAAAAGGAACTAA
GTTATATTACGAGGTGGTGGAAGGAGTTTGATTACAAAAGTAAGCATTCA
TTTATAAAAGACAGAATAGTGGAGTGCTATTTCTGGGTTTATGGAGTGTT
TTTTGAGGCAGAAACTTCCCAAATCAGACTAATAATCACCAAATTAATTG
CTATTCTCACAATAATTGATGATGCTTATGATAGCTTTGGTTCACTTGAA
GAACTAGAGCCTTTTACTCAAGCAATTGAAAGGTGGGATATATGTGCCAT
AGATACTCTGCCTGAGTACATGAAAATATTTTACATGAAACTTTTGGAGA
TCTACAATGAAATTGAACAATTTTCTAAGGAAAGATCATACTGCCCTAGC
TATGCTAAGAAAGGGGTGCAATCTCTAATTAGAGCTTATTTTAAGGAAGC
CAAATGGTTACACACAAAATATATACCAACATTAGATGAATATATGCCAG
TTGGGGTTGATAGTGCAGGATCTTTTATGCTCATTTCAATGGTTTTTATT
GGAATGGGAGATATTGTTACAAAACATTCTATGGATTGGATATTTTCTAA
TCCTCAACCTAAAATTATACAAACTATGGCAATAGTTGGAAGAGTTATGA
ATGACATTGGCTACCATAAGAAGAAATCATCAGGAGAAATTGTGGCTTCA
ACTGTGGAGTGTTACATGAAACAATATGGCGTGACTGGTGAAGAAGCTAT
AGAGAAACTTAGCGAACAAGTTAAAGATTCATGGAAAGATCTCAATGAAG
ATCTTCTCAATCCAATCACTATCTCTAGGCCACTCTTAATGCAAGTTCTA
AAGCTTGTACGAGTGAACCATGAGATTTATAGAGAAGGAGATGGCTTTAC
ACAACCCACTTTGCTCAAGAATTTGATTCATTCTCTCATCATCAATCCAA
TT
Sequence Length
1452
Sequence Checksum
6ca7a664317437940de462ba70cf8122
Summary
Resource Type
mRNA
Organism
Name
TPS58
Identifier
TPS58
Time Accessioned
Friday, October 21, 2022 - 16:42
Time Last Modified
Friday, October 21, 2022 - 16:42