MT295505.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR036965Terpene_synth_N_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..31
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 32..55
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..11
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
NoneNo IPR availableGENE3D1.50.10.160coord: 68..270
e-value: 1.1E-142
score: 477.7
NoneNo IPR availablePANTHERPTHR31739:SF3ENT-KAUR-16-ENE SYNTHASE, CHLOROPLASTICcoord: 52..796
NoneNo IPR availablePANTHERPTHR31739FAMILY NOT NAMEDcoord: 52..796
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 52..52
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 24..51
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..23
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 26..52
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..25
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 49..94
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 29..48
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..28
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 61..479
e-value: 1.1E-142
score: 477.7
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 482..799
e-value: 1.0E-85
score: 289.5
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 470..795
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 231..429
e-value: 2.6E-41
score: 141.4
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 472..739
e-value: 3.0E-70
score: 236.6
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 71..183
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 239..452

  • Cannabis sativa cultivar Purple Kush terpene synthase 65 mRNA
  • partial cds
Sequences
Sequence
GGTGTGACTGCAACACTCACTCATTCTGAGACAACAATCATGTCTCATTC
ATTGCATTCCAACATTAGGTGCTCCTCTTCTTCTTCCTCATCAGCTTCTC
CCATACCAAGACTAAATGGAACAAGTAAAAGCAACATAGCTGTTTTGAAG
TTTGAGGAGACCAAAGAGAGAATAAAGAAGATGTTCAATAATGTTGAACT
CTCTGTCTCGTCTTATGACACTGCCTGGGTGGCAATGATCCCTTCAAATT
CTGGGCATCACCCTTTCTTTCCTCAATGTGTAAATTGGTTACTAGAGAAT
CAGCACTCTGACGGTTCATGGGGTCTTCCTCATCGTCATCCCTTGCTTAT
GAAAGATGCTCTTTTATCTACTTTAACTAGTGTACTTGCAATGAAGCGAT
GGGGTGTTGGCGAAGAACAAATAGACAAGGGCTTGTCTTTCATAGAGGAA
AATATAGCTTCAGCCATTGATGAGAAGCAATGTTCACCTATTGGATTTGA
AGTAATATTTCCTACAATGATTGATTATGCCAAAAAATCAGATCTGAATA
TTACTCTTGAGCCATCCAATCATAATGACCTAGTTCATAACAGAAAGGTT
TCACTTGAAAGAGCCTCAGGAAGCTACTCAGAGGGTCATGAAGCATACTT
AGTGTACATTTCAGAAGGTCTTGGAAAGCCACTGGATTGTGAAAGAGTCT
TTAAGTACCAAAGAAAAAATGGTTCTCTGTTTAATTCTCCATCCACCACA
GCTGTTGCTTTTACAAACCATGGGAATGCTGACTGTCTTAAGTATCTCTG
CTCTGTTGTAGACAAGTTTGGAAGTGCAGTTCCAACAGTATATCCTCTAG
ATATTTATGCTCGTCTCTCAATGGTGGACAATCTCCAAAGGTTGGGGATA
GAACGATTTTTCAAAGAGGAAATCAGAAGTGTACTGGATGAAACATACAA
ATATTGGCTGCAAGGAGAGGAGTGTGTTCTCTTAGATGCTTCCACCTGTG
CAATGGCATTTCGTTTATTGCGTGTTAATGGATATGATGTCTCTTCAGAT
CCATTAGTTCGATTTTCAGAAGATTATATATTCAATTACCTTGGAAATCA
TACGAAGGATATAGATGCTATCTTGGAAATATTTAGAGCATCCGAGATCA
TCATACACCCAAATGAATCAATCTTGGAGAAGCAAAATTTCTGTACAAGT
CATTTTCTAGAACAAGAGTTATTCAGCATTTCAACTAGGGGAGATAAACT
CAATAAAAATATTGGCAAAGTGGTAAGTGAAGCTCTTAAGATTCCTTTCT
ATGCAAACTTGGAACGACTAGCAAGTAGAAGAGCCATAGAGTACTATGAC
ACTGATAGTACGAGGATTCTGAAAACTTCATATTGTTCCTCAAATGTTCG
GAGCAAGGATTTCCTAATATTAGCAGTTGAAGACTTCAACATGTGCCAAT
CAATACACCGTGAAGAACTCAAAATTCTTTCTAGGTGGGTTGTAGAGAAT
AGGTTGGACAAGCTAAAGTTTGCTAGGCAGAAGCTGGCATACTGTTACTT
TTCTGCTGCTGCTACTCTTTCTTCTCCTGAATTATCTGATGCCCGTATAT
CATGGGCGAAAAATGGGGTACTTACTACAGTGGTTGATGATTTTTTTGAT
GTTGGAGGTTCAGAAGAGGAACTAGTAAACCTCATTCAATTGTTGGAAAA
GTGGGATGTAGATGTCAGTGTTGATTGTTTATCGGAGCAAGTTGAAATTA
TTTATTTAGCACTTCATGGCACAATCTCTGAAATTGGAGAAAAGGCGTTC
GTGTGGCAAGGACGTAGTGTGACAAATCACATAATAGAGATTTGGCTGGA
TTTGCTCAAGTCTATGTTGAAGGAAGCTCAATGGTTGAAATACGAGACCG
TCCCAACAATAGATGAGTATATGAAAAATGGATACATATCATTTGCCTTA
GGACCTATAGTCCTTCCAGCACTTTACTTAGTTGGACCTATGCTTTCTGA
GGATGTTACAAGACATCCTGAGCTCCATTATCTATATAAACTCATGAGCA
CTTCCGGACGACTTCTCAACGATATCCACGGCTTCAAGAGAGAATCCAAA
GAAGGGAAACTGAATATAGTGTCATTAAGCCTACTGGCGCGTGGTTTTGG
CTCTGGTTCTTCTTCTGAAGAAGAGATCATTAATGAAATGAAAAGTGTTG
TAAATGGTAAGAGGAGAGAATTGCTGAGGCTAGTTTTTAAGGAAAAAGAT
AGCATTGTTCCAAGAGCTTGCAAGGACTTGTTCTGGAAAATGAGCCAAGT
GTTGCACCTATTTTATGCCAATGACGACGGATTCACCTCAAATGAGATGA
TCAATGTCGCAAAAGCAATAATCGAGGAGCCCATAATTGAAAATAAATTG
TAA
Sequence Length
2403
Sequence Checksum
edf8dea5e109fb2a72796d7a9a1892bc
Summary
Resource Type
mRNA
Accession
MT295505.1
Organism
Name
MT295505.1
Identifier
MT295505.1
Time Accessioned
Friday, October 21, 2022 - 20:07
Time Last Modified
Friday, October 21, 2022 - 20:07