MN967479.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR005630Terpene_synthase_metal-bd

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..36
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 37..49
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..11
NoneNo IPR availableTMHMMTMhelixcoord: 12..34
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..39
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 40..67
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 68..69
NoneNo IPR availableTMHMMTMhelixcoord: 45..67
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 11..342
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 11..342
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 246..342
e-value: 1.1E-40
score: 139.7
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 31..215
e-value: 1.2E-53
score: 181.7
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 31..342
e-value: 2.3E-112
score: 378.0
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 241..342
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 70..240
e-value: 2.3E-112
score: 378.0
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 28..241

  • Cannabis sativa cultivar Purple Kush terpene synthase 26 mRNA
  • complete cds
Sequences
Sequence
ATGTCCACTCAAATCTTAGCTTCATCATCATCATCCAAAAATGACAAAAT
ACATAAAATTGTTCGACCAACAACAAATTATCATCCATCTATTTGGGGAG
ACCGATTCTTACATTTCAATATTCCAGAAGAAGAATTGAGTTATAAACAA
GGCCAAGTTGAAGAATTGAAAGAAGTGGTAAGAAAGGAGATATTTGGAGA
ATTATTATGTGATGATTGGAATAATCGATTGAAGTTAATTGATGTGGTAG
AACGTTTGGGATTGTCCTATCATTTTGAGAGTGAAATACAAAATGAGCTT
CAATACATTTACAACAAAATAAGCATTAATGATACTAATTTCAAACATGA
AACTTTGCATGATGCTTCTATTCGGTTTAGACTTCTACGACAACATGGAT
ACAGGGTTTCTTTAGATATATTTGACAAGTTCAAAGATGAGAATGGAAAC
TTTAAAGAATGTTTGGGGAGTGACATCATCAGTTTGCTTAGCTTATACGA
GGCCTCACATTTGAGCTGTGTTGGAGAAAATGTTCTAGATGAAGCCCTAT
CTTTCACTACCACACACCTAACTAAATTTTTGGCAAATAATAAAAAAGAA
CATCCCGATGATGATCCATTATCGAAAGAAATATCCCAAGCCCTAGAGAG
GCCCTTAAGAAAGACCCTAGTGAATCTTCATGCAAGGCATTTCATTTCAA
TATATGAAAAAGATGCTTCACATAACAAAGTATTGTTGCAACTTGCAAAG
TTAGATTTCAATTTATTGCAATGCATGCACAAAAAGGAACTTAGTGAAAT
CTCAAGGTGGTGGAAGGAATTAGACAGTGCACACAACTTTCCATTTGCAA
GAAATAGGATTGTGGAACTATACATTTGGATATTAGGAGTCTATTATGAA
CCCCAATACTCTTTTGCAAGAAATATTTTAGTGAAGATCATAGCCCTTGC
CTCAATTGCTGATGATATTTATGATTCATATGGTATATTTGAAGAACTTA
AGCTCCTTAATGATGCAATTGACAGGTGA
Sequence Length
1029
Sequence Checksum
353fb233643c5db02b10146e1fe2b0d1
Summary
Resource Type
mRNA
Accession
MN967479.1
Organism
Name
MN967479.1
Identifier
MN967479.1
Time Accessioned
Friday, October 21, 2022 - 20:06
Time Last Modified
Friday, October 21, 2022 - 20:06