TPS17

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR036965Terpene_synth_N_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..31
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 32..50
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..14
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 15..36
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 37..42
NoneNo IPR availableTMHMMTMhelixcoord: 15..37
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 31..43
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..30
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..11
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..26
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 27..58
NoneNo IPR availableTMHMMTMhelixcoord: 5..27
NoneNo IPR availableCOILSCoilCoilcoord: 239..259
NoneNo IPR availablePANTHERPTHR31225:SF9coord: 68..629
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 68..629
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 495..632
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 476..494
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..475
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..21
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 22..41
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 42..54
NoneNo IPR availableTMHMMTMhelixcoord: 20..39
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..11
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 30..60
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..29
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 115..299
e-value: 2.0E-196
score: 655.3
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 78..249
e-value: 2.8E-49
score: 167.4
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 306..573
e-value: 2.3E-94
score: 315.7
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 78..613
e-value: 2.0E-196
score: 655.3
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 300..628
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 76..299

TPS17
Sequences
Sequence
ATGGCTTTTCACCAATTTGCTCCATCATCATCCCTCCCTATTTGGAGTAG
AATTAATAATCGTTTTACACCAAAAACTTCTATTATTACTTCTATTTCAA
AACCAAAATCAAACTTGAAATCGAGATCGAGATCAAGTACTTGCTACCCC
ATACAATGTACTGTGGTCGATAACCCTAGTTCTACGATTACTAATAATAG
TGATCGAAGATCAGCCAACTATGGACCTCCCATTTGGTCTTTTGATTTTA
TTCAATCTCTTCCAATCCAATATAAGGGAGAATCCTATACAAGGCAATTA
AATAAGTTGAAGAAAGAAGTGACAAGAATGGTCCTTGGACTGGAAATTAA
CTCTTTAGCCCTACTTGAGCTAATTGATACATTGCAAAGGCTTGGAATAT
CTTACCATTTTAAGAATGAAATAAACACTATTTTGAAGAAAAAATACACT
GATAATTATATTAACAATAATATTATTATTACTAACCCTAATTATAATAA
TTTATATGCCATTGCTCTCGAATTTAGGCTTCTACGCCAACATGGCTATA
CAGTACCTCAAGAAATTTTTAATGCTTTCAAGGATAAGAGAGGGAAATTT
AAAACATGCTTGAGTGATGATATTATGGGAGTATTGTGTTTATATGAAGC
TTCATTCTATGCTATGAAACATGAAAATATTTTGGAGGAAGCAAGAATTT
TTTCAACTAAATGTCTTAAAAAATACATGGAGAAAATGGAGAATGAGGAA
GAGAAAAAAATATTATTATTAGATGATAATAATATTAATAGTAATTTGCT
ATTAATTAATCACGCTTTCGAGCTTCCGCTTCATTGGAGAATAACAAGAT
CGGAAGCTAGGTGGTTCATTGACGAAATATATGAGAAAAAACAAGACATG
AATTCGACTTTGTTCGAGTTTGCGAAATTAGATTTTAATATAGTGCAATC
AACACACCAAGAAGATTTACAACATTTATCGAGGTGGTGGAGGGATTGTA
AACTTGGTGGGAAATTGAATTTTGCTAGAGATAGATTGATGGAAGCTTTC
TTATGGGATGTTGGACTAAAATTCGAGGGAGAATTCAGCTATTTTAGAAG
AATAAATGCAAGATTATTTGTGCTTATAACAATAATTGATGATATTTATG
ATGTATATGGAACTTTGGAGGAATTAGAGCTTTTCACTAGTGCTGTTGAA
AGATGGGATGTGAAATTAATCAATGAGTTACCAGATTACATGAAGATGCC
TTTCTTTGTTTTACACAATACCATAAATGAGATGGGGTTCGATGTATTAG
TACAACAAAACTTTGTCAACATTGAATACCTTAAGAAATCGTGGGTAGAT
TTATGTAAATGTTATTTACAAGAAGCAAAATGGTATTATAGTGGATACCA
ACCAACATTGGAAGAATACACTGAGTTGGGTTGGCTTTCAATAGGAGCAT
CAGTAATTCTTATGCATGCTTATTTTTGTTTCACAAATCCTATAACAAAA
CAAGACTTGAAAAGTTTGCAATTGCAACATCATTATCCCAACATAATTAA
ACAAGCATGCTTGATTACAAGGCTTGCAGATGATTTAGGAACATCTTCGG
ATGAATTGAATAGAGGCGACGTTCCTAAATCGATTCAATGTTACATGTAC
GATAATAATGCTACCGAAGACGAAGCTCGTGAACACATCAAGTTCTTGAT
AAGTGAAACATGGAAGGATATGAATAAGAAAGATGAAGATGAGAGTTGTT
TATCAGAAAATTTTGTTGAAGTTTGCAAAAATATGGCTAGAACAGCACTA
TTCATATATGAGAATGGAGATGGACATGGTTCTCAGAATAGTTTATCAAA
AGAACGTATTTCAACCTTGATTATTACTCCAATTAATATTCCTAAA
Sequence Length
1896
Sequence Checksum
ed0e60b1b9e1095dd092c7ee57901cbe
Summary
Resource Type
mRNA
Organism
Name
TPS17
Identifier
TPS17
Time Accessioned
Friday, October 21, 2022 - 20:06
Time Last Modified
Friday, October 21, 2022 - 20:06