TPS14

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR036965Terpene_synth_N_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..30
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..11
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 31..41
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..19
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 20..39
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 40..41
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 70..86
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..51
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 52..69
NoneNo IPR availableTMHMMTMhelixcoord: 52..74
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 21..44
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 45..54
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..20
NoneNo IPR availableTMHMMTMhelixcoord: 21..43
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..26
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 27..40
NoneNo IPR availableTMHMMTMhelixcoord: 10..32
NoneNo IPR availableCOILSCoilCoilcoord: 350..370
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 5..550
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 5..550
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 30..42
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..29
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..11
NoneNo IPR availableTMHMMTMhelixcoord: 10..29
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 65..223
e-value: 1.4E-190
score: 636.0
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 229..494
e-value: 2.4E-103
score: 345.1
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 28..534
e-value: 1.4E-190
score: 636.0
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 224..552
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 29..198
e-value: 1.0E-51
score: 175.4
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 25..224

TPS14
Sequences
Sequence
ATGTCAAATATTCAAGTCTTAGCTTCATCTCAATTAAGTGACAAAATTAT
TGCTCGTCCAACAACAAATTTTCACCCTTCTATTTGGGGCGATCGATTCC
TCCATTACAATATTTCAGAACAAGATTTGGTTTGCAAAGAAGAAAGAATT
GAAGAATTAATACAAGTTGTAAAGAAAGAGATATTATCTTCAAATCATGA
TCAATTGAAGTTGATTGACAATCTCCAACGTTTGGGATTATCACATCATT
TTGAGAGTGAAATTGAGAAATTGTTGGAACAATTAAATATCGGCACTCAT
CATCAAAATCATCAAGATCTACATGATGCTTCTCTTTGGTTTAGATTATT
AAGACAACATGGATTTAATGTTTCATCAAGTATATTTGAAAAATTTAAAG
ACGAGAAAGGTAACTTTAAAGAAAGCCTAATAACTGATGTTCCAGGTTTG
CTTAGCTTGTATGAGGCTTCCCACTTGAGTTATGTTGGAGAAAGCATACT
AGATGAAGCACTTGCTTTCACAACTACTCACCTTAAGGCTATTGTGGCAA
ATAGTAAAGATCATCCATTATCACATCAAATATCCATAGCCTTGCATAGG
CCTCTAAGAAAGACCATAGAGAGGCTTCATGCTAGGTTTTACATCTCAAT
CTATGAAAAGGATGCCTCTCATAACAAAGTATTGCTAGAGCTTGCAAAGT
TAGATTTCAATCTACTTCAATGTTTCCACAAAAAGGAACTTAGTGAAATT
ATGAGGTGGTGGAAAGAGCATGAGTTTGCAAAGAAATTTCCTTTTGCAAG
AGATAGGATGGTGGAACAGTATTTTTGGATATTGGGTGTATATTATGAAC
CCAAATACTCTCGAGCAAGAAAACTTCTAACCAAAGTCATTGCATTAGCC
TCAATCACTGATGATATTTATGATGCATATGGTACTATTGATGAGCTTGA
GCTTCTTACAAAAGCAATGCAAAGGTGGGACATAACTTGTATGGATAAAC
TTGAGCCAGAATATTTAAAGACATATTATAAGGCAATGTTGGATTCTTAT
GAAGAATTTGAAAAGGAGCTTAAAAAGGAAGAATTATACAAACTTGAGTA
TGCAAAAGAAGAGATGAAAAGAATTATTGGAGCTTATTTTGAAGAAGCTC
GATGGTTGAGTGAAGGATATTTGCCAAGGTTGGATGAGCATTTGAGAGTT
TCATATGTTTCTTGTGGTTACGTTTTGTTGATAGCCACAAGTTATGTAGG
AATGCATGATATTGTAACACATGAAACTCTAAATTGGCTCTCCAAAGACC
CTAAAATTGTTTCAGCTTCCACTCTCCTTGCTAGGTTCATGGATGATATT
GGTTCTCGCAAGTTTGAGCAAAAGAGAAATCACATACCATCTACAGTGGA
TTGTTACATGAAACAATATGGGGTATCAGAGGAAGAGGCAATTAAAGAAC
TTAATAAAAGAGTGGACACCCACTGGAAAGAAATTAATGAAGACTTTATT
AGGCCAACTGTTGTGCCTTTTCCTATCTTAGTTCGTGTTCTTAATTTTAC
AAAAACAGTAGATCTTCTTTACAAAGAGGGCGATGATCAATACACAAATG
TTGGAAAAGTGCTCAAAGAAAGCATTGCTGCTTTGCTTATAGATTCAATC
CCATTA
Sequence Length
1656
Sequence Checksum
c0140df7d29b86eebb1f6c969cff06a1
Summary
Resource Type
mRNA
Organism
Name
TPS14
Identifier
TPS14
Time Accessioned
Thursday, October 20, 2022 - 11:31
Time Last Modified
Thursday, October 20, 2022 - 11:31