TPS53

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR001633EAL_dom

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR001633EAL domainPROSITEPS50883EALcoord: 1..57
score: 8.906
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 40..40
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 17..39
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..16
NoneNo IPR availableTMHMMTMhelixcoord: 17..39
NoneNo IPR availableCOILSCoilCoilcoord: 40..60
NoneNo IPR availablePANTHERPTHR31225:SF74TRICYCLENE SYNTHASE, CHLOROPLASTICcoord: 6..558
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 6..558
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 66..66
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 45..65
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..44
NoneNo IPR availableTMHMMTMhelixcoord: 46..65
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..30
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 31..46
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..11
NoneNo IPR availableTMHMMTMhelixcoord: 13..35
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..31
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 50..63
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 32..49
NoneNo IPR availableTMHMMTMhelixcoord: 27..49
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 18..542
e-value: 2.4E-188
score: 628.6
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 231..559
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 235..501
e-value: 2.0E-94
score: 315.9
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 18..181
e-value: 1.6E-48
score: 165.0
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 55..229
e-value: 2.4E-188
score: 628.6
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 16..230

TPS53
Sequences
Sequence
GATAGTTCTGTTACTAATATTGTTCGAAGATCAGCCAACTTTGAACCATC
CATTTGGTCTTTTGATTTCGTTCAGTCTCTTTCAAGCAAATATAAGGGAG
AACCTTATACAAGTCGAGTAAAAAAACTCGACGAAGATGTGAAAAGGATG
CTAGTTGAGATGGAAAACTCTTTAGCTCAACTTGAACTCATTGACACGTT
ACAAAGACTTGGAGTATCTTATCGTTTTGAGAATGAAATAAATACTATTT
TAAAAGAAAAATATGTCAATATTAATGGTAATATTAATAACCCTAATTAT
AATTTATATGCCACTGCTCTTGAATTTAGGCTTCTACGTCAACATGGTTA
TGCTGTACCTCAAGAGACTTTTAATTATTTTAAGGACGAGACAGGAAAAT
TCAAAACAAACATAAGTGGTGATATCATTGGAGTATTGGCCTTATATGAA
GCTTCATTCTATGAAAAAAAAGGCGAAAACATTTTAGAGGAAGCTAGAAT
TTTCACAACTGAACGTCTCAAAAACTACATAATGATATCAGAGCAAAAGA
AATTGATGATTAATAATAATTATGATTATTATTACGATATTGAAGTAGTG
AATCATGCTTTGGAGCTCCCACTTCATCGAAGGACCACAAGAATAGAAGC
TAAGTGGTTCATCGATATGTACAAGAAAAAACAAGACATGAATCCTATTT
TGCTTGAGTTTGCCAAACTCGATTTCAACATGATACAATCAACACATCAT
GAAGATTTGAAACATATATTCAGGTGGTGGAGGCATACTAAACTTGGTGA
GAAATTGAATTTTGCAAGAGATCGATTGATGGAATGTTTTTTATGGAAAG
TTGGAATAAGATTTGAGCCAAAATTCAGTTATTTTAGAACAACTGTCAAA
TTACTTGAGCTAATAACATTAATTGATGATATATATGATGTTTATGGAAC
ATTAGATGAATTAGAGCTTTTCACCAAAGCTATTGAGAGATGGGATGTGG
AAATGATAAATGAATTACCAGAATACATGAAAATGCCTTATATTGTTTTA
CACAATACAATAAATGAAATGGTATTTGAGATATTAAGAGATCAACAAAT
CACCATCAAAATTCAATACTTAAAGAAAACGTGGGTAGATATGTGTAGAT
GTTTTCTACAAGAAGCAAAATGGTACTACAGTGGATACACACCAACATTG
GAAGAATATATTGAAAATGGTTGGATTTCAGTGGGAGCACCAGTTCTTAT
TGTGCATGCTTATTTTTCTCATTCAAATAATAATAAAGAGATTTTCGAAT
GCTTGGAACATGGTTATTATCCTACCATAATTCGTCACAGTGCCATAATA
ATACGACTTACAAATGACCTAGCAACATCATCTGAGGAACTGAAAAGAGG
TGATGCTCCGACGTCAATTCAATGTTACATGCAAGAAAAAAATATATGTG
AAGAGGAAGCTCGTGAACATATTAAGTTTTTAATAAGTGAAGCGTGGAAG
GAGATGAATAACAGTGAATCTGATGATGGATTAATATATCCAATCTCATT
GATTGAAGATGCGAGAAACTTTGCTAGGATAGGATTATTCATGTATCAAC
ATGGTGATGGTCACAGTTCTCAGGATAATCTATCCAAAGAAAGAATTTCA
TCCTTTATTATTAAACCTATTCCCCTA
Sequence Length
1677
Sequence Checksum
e3e7007caad6481caa2aa83ecde55755
Summary
Resource Type
mRNA
Organism
Name
TPS53
Identifier
TPS53
Time Accessioned
Friday, October 21, 2022 - 20:05
Time Last Modified
Friday, October 21, 2022 - 20:05