TPS51

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR001906Terpene_synth_N

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 66..66
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 45..65
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..44
NoneNo IPR availableTMHMMTMhelixcoord: 46..65
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 40..40
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 17..39
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..16
NoneNo IPR availableTMHMMTMhelixcoord: 17..39
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 49..62
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 30..48
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..29
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..30
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 31..46
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..11
NoneNo IPR availableTMHMMTMhelixcoord: 13..35
NoneNo IPR availableCOILSCoilCoilcoord: 40..64
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 8..559
NoneNo IPR availablePANTHERPTHR31225:SF9coord: 8..559
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..36
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 37..53
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 18..179
e-value: 5.5E-49
score: 166.5
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 55..230
e-value: 7.1E-190
score: 633.7
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 236..502
e-value: 1.9E-96
score: 322.5
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 18..543
e-value: 7.1E-190
score: 633.7
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 231..558
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 16..231

TPS51
Sequences
Sequence
GATAGTTCTGTTACTAATATTGTTCGAAGATCAGCCAACTTTGAACCATC
CATTTGGTCTTTTGATTTCATTCAGTCTCTTTCAAGCAAATATAAGGGAG
AACCTTATACAAGTCGAGTAAAAAAACTCGAGGAAGATGTGAAAAGGATG
CTAGTTGAGATGGAAAACTCTTTAGCTCAACTTGAACTCATTGACACGTT
ACAAAGACTTGGAGTATCTTATCGTTTTGAGAATGAAATAAATACTATTT
TAAAAGAAAAATATGTCAATATTAATGGTAATATTAATAACCCTAATTAT
AATTTATATGCCACTGCTCTTGAATTTAGGCTTCTACGTCAACATGGTTA
TGCTGTACCTCAAGAGACTTTTAATTATTTTAAGGACGAGACAGGAAAAT
TCAAAACAAACATAAGTGGTGATATCATGGGAGTATTGGCCTTATATGAA
GCTTCATTCTATGAGAAAAAAGGCGAAAGCATTTTAGAGGAAGCTAGAAT
TTTCACAACTGAATGTCTCAAAAACTACACAATAATGATATCAGAGCAAA
AGAAATTGATGATTAATAATAATTATGATTATTATTACGATATTGAAGTA
GTGAATCATGCTTTGGAGCTCCCACTTCATCGAAGGACCACAAGAATAGA
AGCTAAGTGGTTCATCGATACGTATAAGAAAAAACAAGACATGAATCCTA
TTTTGCTTGAGTTTGCCAAACTCGATTTCAACATGATACAATCAACACAT
CATGAAGATTTGAAACATATATTCAGGTGGTGGAGGCATACTAAACTTGG
TGAGAAATTGAATTTTGCAAGAGATCGATTGATGGAATGTTTTTTATGGA
AAGTTGGAATAAGATTTGAGCCAAAATTCAGTTATTTTAGAACAACAACT
GTCAAATTACTTGAGCTAATAACATTAATTGATGATATATATGATGTTTA
TGGAACATTAGATGAATTAGAGCTTTTCACCAAAGCTATTGAGAGATGGG
ATGTGGAAATGATAAATGAATTACCAGAATACATGAAGATGCCTTATATT
GTTTTACACAATACAATAAATGAAATGGTATTTGAGATATTAAGAGATCA
ACACATCACCATCAAAATTCAATACTTAAAGAAAACGTGGGTAGATCTGT
GTAGATGTTTTCTACAAGAAGCAAAATGGTATTACAGTGGATACACACCA
ACATTGGAAGAATATATTGAAAATGGTTGGATTTCAGTGGGAGCACCAGT
TCTTATTGTGCATGCTTATTTTCATTCAAATAATAATAAAGAGATTTTCG
AATGCTTGGAACATGGTTATTATCCTACCATAATTCGTCACAGTGCCATA
ATAATACGACTTACAAATGACCTAGCAACATCATCTGAAGAACTGAAAAG
AGGTGATGCTCCGACGTCAATTCAATGTTACATGCAAGAAAAAAATATAT
GTGAAGAGGAAGCTCGTGAACATATTAAGTTTTTAATAAGTGAAGCGTGG
AAGGAGATGAATAACAGTGAATCTGATGATGGATTAATATATCCAATCTC
ATTGATTGAAGATGCGAGAAACTTTGCTAGGATAGGATTATACATGTATC
AACATGGTGATGGTCACAGTTCTCAGGATAATCTATCCAAAGAAAGAATT
TCATCCTTTATTATTAAACCTATTCCCCTA
Sequence Length
1680
Sequence Checksum
9f8cd609b1abadef7a52db292830f42b
Summary
Resource Type
mRNA
Organism
Name
TPS51
Identifier
TPS51
Time Accessioned
Friday, October 21, 2022 - 20:05
Time Last Modified
Friday, October 21, 2022 - 20:05